Skip to main content

Table 6 Sequences of the oligonucleotide primers used in this study

From: Conferring cellulose-degrading ability to Yarrowia lipolytica to facilitate a consolidated bioprocessing approach

Primer names Sequence (5′-3′), 15-bp homologous sequence for infusion is underlined
F1 GTTCTCCAGAAGCGACAGCAACCGGGTACCAGCAC
R1 CACAGACACCCTAGGCTAAAGGCATTGCGAGTAGTAGTCGT
F2 GTTCTCCAGAAGCGAGCACAGCAGACTGTCTGGGGCC
R2 CACAGACACCCTAGGCTACTTTCTTGCGAGACACGAGCTGAC
F3 GTTCTCCAGAAGCGAGCCCAGGCTTGCTCAAGCGTC
R3 CACAGACACCCTAGGTTACAGGAACGATGGGTTTGCGT
JMP1F CCTAGGGTGTCTGTGGTATCTAAGCTATT
JMP1R TCGCTTCTGGAGAACTGCGG
F4 ACACCCGAAGGATCCCACAATGAAGCTTTCCACCATCC
R4 ATGGTGATGATGGTGAAGGCATTGCGAGTAGTAGTCGT
R5 ATGGTGATGATGGTGCTTTCTTGCGAGACACGAGCTGAC
R6 ATGGTGATGATGGTGCAGGAACGATGGGTTTGCGT
JMP2F CACCATCATCACCATCATTAAAACT
JMP2R GGATCCTTCGGGTGTGAGTTG
HTF ATCCCTAGAATCGATGCCGCCGCAAGGAATGG
HTR GCCAACCCGGTCTCTGCACTTTTGCCCGTGATCAGTG
JMP3F AGAGACCGGGTTGGCGG
JMP3R ATCGATTCTAGGGATAACAGGGTAATT