Skip to main content

Advertisement

Table 1 Plasmids, strains, and primers used in this study

From: Effects of global transcription factor NtcA on photosynthetic production of ethylene in recombinant Synechocystis sp. PCC 6803

Plasmids, strains, and primers Derivation and/or relevant characteristics References or source
Plasmids
pMD19-Ts Apr, cloning vector Takara
pFL-XS AprCmr, a BioBrick “T” vector used for functional block assembling [5]
pHM001 Apr, pMD19-Ts derivative containing the sll1423 ORF with flanking regions This study
pHM002 AprKmr, pMD19-Ts derivative used to knock out sll1423 (ntcA) by insertional inactivation with kanamycin resistance cassette This study
pHM003 AprKmr, pMD19-Ts derivative used to delete sll1423 (ntcA) with kanamycin resistance cassette This study
pHM004 Apr, pFL-XS derivative containing the sll1423 ORF This study
pHM005 AprGmr, pFL-XS derivative containing Gmr-P cpcB -ntcA expression cassette This study
pHM006 AprGmr, pFL-XS derivative used to express Gmr-P cpcB -ntcA expression cassette at phaAB locus This study
pHM008 AprGmr, pMD19-Ts derivative used to inactivate sll1423 with the gentamycin resistance cassette This study
pHM009 AprGmr, pFL-XS derivative containing Gmr-P cpcB -efe expression cassette This study
pHM010 AprGmr, pFL-XS derivative used to express Gmr-P cpcB -efe expression cassette at sll1423 locus This study
pXX55 Apr, pFL-XS derivative containing P cpcB -efe expression cassette [5]
pXX58 AprGmr, pFL-XS derivative containing the Gmr cassette aacC1 [5]
pXX62 AprGmr, pFL-XS derivative containing Gmr-P cpcB cassette [5]
pKC104 Apr, pMD18-Ts derivative containing upstream and downstream fragments of phaAB operon [26]
pRL446 AprKmr, plasmid containing the Kmr cassette Prof. X. Xu
Synechocystis strains
S. PCC 6803 Synechocystis sp. PCC 6803 wild-type Prof. X. Xu
XX76 slr0168::Spr-P cpcB -efe [5]
MH013 sll1423::Kmr (Insertional inactivation) This study
MH015 sll1423::Kmr (Deletion) This study
MH017 phaAB::Gmr-P cpcB -ntcA This study
MH021 slr0168::Spr-P cpcB -efe/sll1423::Kmr This study
MH023 slr0168::Spr-P cpcB -efe/phaAB::Gmr-P cpcB -ntcA This study
XX109 slr0168::Spr-P cpcB -efe/sll1981::Kmr-P cpcB -efe/slr0370::Cmr-P cpcB -efe [5]
MH039 slr0168::Spr-P cpcB -efe/sll1981::Kmr-P cpcB -efe/slr0370::Cmr-P cpcB -efe/sll1423::Gmr This study
MH043 slr0168::Spr-P cpcB -efe/sll1981::Kmr-P cpcB -efe/slr0370::Cmr-P cpcB -efe/sll1423::Gmr-P cpcB -efe This study
Primers (5′→3′) a
Detection primers for ntcA site (slr1423) in single-copy efe recombinants
ntcA-d1 GTTACTCAGCACAACGGGGTC  
ntcA-d2 TTGCAGCCCTTCGCCAGCTGGCACGTTCACGGTAATGGGG PvuII
kan-1 CCCCATTACCGTGAACGTGCCAGCTGGCGAAGGGCTGCAA PvuII
kan-2 GCACTGGTCATAGAGGGTGGCAGCTGGCACGACAGGTTTC PvuII
ntcA-d3 GAAACCTGTCGTGCCAGCTGCCACCCTCTATGACCAGTGC PvuII
ntcA-d4 TAACTGACCCCGCAGAATGGC  
ntcA-x1 ATGGATCAGTCCCTAACCC  
ntcA-x2 TTAGGTAAACTGTTGACTGAGAGC  
phaAB-3 GCCTTGGGCTAAGTTATTGAGCG  
phaAB-4 TAGGATTCTTGCACAGTACCGC  
Quantitative real-time PCR
rnpB-f1 TGAGGACAGTGCCACAGAA  
rnpB-f2 AATTCCTCAAGCGGTTCCAC  
rrn16Sa-f1 CCAACATCTCACGACACGA  
rrn16Sa-f2 ACTAGGCGTGGCTTGTATCG  
ntcA-f1 CGGCGGAACGGGTTTATT  
ntcA-f2 CAATGACAGGTCGGGATGC  
Detection primers for ntcA site (slr1423) in multi-copy efe recombinants
ntcA-5 GGCAGTGTGGAGCGCATGTAAT  
ntcA-6 AGTAATCACCGTCAACAATACCGC  
slr0168-1 ACCTCTCCACGCTGAATTAG [5]
slr0168-2 TTCCAGGCCACATTGTTGTC [5]
sll1981-1 GGGCTTCGTTAGGTTGTGTGGC [5]
sll1981-2 CCGCATGGCCGTTTCCAACTCC [5]
slr0370-1 GCCGAGGAATACTTAGCCGATG [5]
slr0370-2 CTGCCCTATGAACCGAATATGG [5]
  1. Ap, ampicillin; Km, kanamycin; Sp, spectinomycin; Cm, chloramphenicol; Gm, gentamycin
  2. aRestriction enzyme sites added in the primers were underlined and listed