Skip to main content

Advertisement

Table 2 Oligonucleotides used

From: Management of enzyme diversity in high-performance cellulolytic cocktails

References DNA sequence
[1] ACCGAGCTCGTAGCACTCGCTGTGTATCCTC
[2] CCTGGATCCCTTATACCCAGGACATTCACAGTTC
[3] AGCTCCACCGCGGTGGCGGCCGCGATTAACAGGCTTGTTAAAGGAAGTCTTCACG
[4] TAGGTTAGAGCTGCAGCCCGGGGAAACAAGCAACTATCTCGGGGCGGGA
[5] ACCGAATTCATCAAATGGATAGGTCGGTAATG
[6] CACCTCGAGCAAGGAAGTCGAGTACGAGTCC
[7] CATGGTCATAGAATTCGATATCCATGGGCCTGATTGGGTTCATTGACCATG
[8] GGGTACCGGGCCCCCCCTCGAGACATGGGCGCCCTCTTTAGTGGTGGACTTA
[9] GGCTCGAGATCTACAAGACTG
[10] GTAGTTGGACACGTTGGTGA
[11] CCTACACGCCCAATGCTCGAGCTTGCTC
[12] TCCGTCCAATCAGAGTGGAACGAATCAACA