Skip to main content

Advertisement

Table 2 KmADH and KmATF CRISPR–Cas9 target sequences and knockout efficiencies

From: CRISPR–Cas9-enabled genetic disruptions for understanding ethanol and ethyl acetate biosynthesis in Kluyveromyces marxianus

Target SgRNA Gene disruption Indel success
KmADH1 AGACTTCAAAGCCTTGTACA WT CCGTGTACAAGGCTTTGAAG KO CCG--------GCTTTGAAG 2/10
KmADH2 GGTACCAGCTGGGATGTGAG WT AAGCCGCTCACATCCCAGCT KO AAGCCGCT-----CCCAGCT 4/30
KmADH3 GCTATTCCAGAAAAGCAAAA WT CAGAAAAGCAAAAGGGTGTT KO CAGAAAA-----AGGGTGTT 2/10
KmADH4 GCCATCCCAGAATCCCAAAA WT TCCCAGAATCCC-AAAAGGG KO TCCCAGAATCCCAAAAAGGG 4/10
KmADH5 ATGGTCTTGAAAGAACACAA WT GGTCTTGAAAGAA-CACAAG KO GGTCTTGAAAGAACCACAAG 1/10
KmADH6 GTACCACCACCGCAAAGTAG WT CTACTTTGCGGTGGTGGTA KO CTACTT-GCGGTGGTGGTAC 2/10
KmADH7 GCTTGAGCTGAGAGATTGAT WT AAGTCCCATCAA-TCTCTCA KO AAGTCCCATCAAATCTCTCA 3/5
KmATF ATATAGTCTTCGGCAACACC WT CGGTGTTGCCGAAGACTAT KO CGGTG--GCCGAAGACTATA 4/10