Skip to main content

Table 2 KmADH and KmATF CRISPR–Cas9 target sequences and knockout efficiencies

From: CRISPR–Cas9-enabled genetic disruptions for understanding ethanol and ethyl acetate biosynthesis in Kluyveromyces marxianus

Target SgRNA Gene disruption Indel success
KmADH1 AGACTTCAAAGCCTTGTACA WT CCGTGTACAAGGCTTTGAAG
KO CCG--------GCTTTGAAG
2/10
KmADH2 GGTACCAGCTGGGATGTGAG WT AAGCCGCTCACATCCCAGCT
KO AAGCCGCT-----CCCAGCT
4/30
KmADH3 GCTATTCCAGAAAAGCAAAA WT CAGAAAAGCAAAAGGGTGTT
KO CAGAAAA-----AGGGTGTT
2/10
KmADH4 GCCATCCCAGAATCCCAAAA WT TCCCAGAATCCC-AAAAGGG
KO TCCCAGAATCCCAAAAAGGG
4/10
KmADH5 ATGGTCTTGAAAGAACACAA WT GGTCTTGAAAGAA-CACAAG
KO GGTCTTGAAAGAACCACAAG
1/10
KmADH6 GTACCACCACCGCAAAGTAG WT CTACTTTGCGGTGGTGGTA
KO CTACTT-GCGGTGGTGGTAC
2/10
KmADH7 GCTTGAGCTGAGAGATTGAT WT AAGTCCCATCAA-TCTCTCA
KO AAGTCCCATCAAATCTCTCA
3/5
KmATF ATATAGTCTTCGGCAACACC WT CGGTGTTGCCGAAGACTAT
KO CGGTG--GCCGAAGACTATA
4/10