Skip to main content

Table 1 Sequences of primers used for this study

From: Metabolic engineering of Rhodopseudomonas palustris for the obligate reduction of n-butyrate to n-butanol

Primer Length Sequence (5′ → 3′) Purpose
pBBR1MCS-2 vector
 XhoI GFPmut2 F1 60 GGCGGCCTCGAGAGGAGGATCTATTCATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTG Cloning GFPmut2
 XbaI GFPmut2 R1 51 GCCGCCTCTAGACTATTTGTATAGTTCATCCATGCCATGTGTAATCCCAGC  
 BamHI RBS AdhE2824 F1 68 GCCGCGGATCCAGGAGGATCTATTCATGAAAGTTACAAATCAAAAAGAACTAAAACAAAAGCTAAATG Cloning adhE2 824
 SacI 6X His AdhE2824 R1 62 CACCCGGAGCTCTAAGTGGTGATGGTGATGATGAAATGATTTTATATAGATATCCTTAAGTT  
 SacI AdhE2824 R1 43 CACCCGGAGCTCTAAAATGATTTTATATAGATATCCTTAAGTT  
 XhoI RBS AdhEBisB18 F1 57 GACGACCTCGAGAGGAGGATCTATTCGTGACCTTATCTACCCCGTCCGACCTCGACA Cloning adhE BisB18
 XbaI 6X His AdhEBisB18 R1 60 CACCCGTCTAGACTAGTGGTGATGGTGATGATGTTCCGCGGCGTTCGCCGTCGCCACCGA  
 XbaI AdhEBisB18 R1 52 CAGTCACCCGTCTAGACTATTCCGCGGCGTTCGCCGTCGCCACCGACAATGT  
pMG105P vector
 XbaI GFPmut2 F1 60 GGCGGCTCTAGAAGGAGGATCTATTCATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTG Cloning GFPmut2
 SalI GFPmut2 R1 53 GGCGGCCGGTCGACCTATTTGTATAGTTCATCCATGCCATGTGTAATCCCAGC  
  1. Restriction sites are underlined