Skip to main content

Table 2 Primers used in the experiments

From: Impairment of NADH dehydrogenase and regulation of anaerobic metabolism by the small RNA RyhB and NadE for improved biohydrogen production in Enterobacter aerogenes

Primers Oligonucleotide sequence (from 5′ to 3′) PCR fragment Source
F-CDuh CCCTGCAACTTCGGCCTGTCA Upstream-homologous arm of nuoB This study
R-CDuh TGATTCTCGTGCATTTAAATCTCGTCCGGTGT This study
F-CDdh ACCGGACGAGATTTAAATGCACGAGAATCAAC Downstream-homologous arm of nuoE This study
R-CDdh CTGCTCCAACAGGTCAGGAATCG This study
F-CDEuh AGCAAGAAGTCAATAAAAGCGT Upstream-homologous arm of nuoB This study
R-CDEuh ATCACTGTCTTCATTTAAATCTCGTCCGGTGT This study
F-CDEdh CGAGATTTAAATGAAGACAGTGATCCGCA Downstream-homologous arm of nuoF This study
R-CDEdh ACGGCCTTCAAGGGAGTTAATC This study
F-nuoCD TCCTAGGTATAATACTAGTGGCGAACTGCGCAATCGTTTTGGGTTTTAGAGCTAGAAATAGC nuoCD-N20 This study
R-nuoCD ACTAGTATTATACCTAGGACTGAGCTAGCTGTCAAG This study
F-nadE CCGGAATTCATGACGCTACAACAAGAGATT nadE ORF fragment This study
R-nadE CCCAAGCTTCTATTTTTTCCAGAAATCGTC This study
F-p102-Chol TGCACGGTGCACAGTGCCAAGC TTGCATGCCT Chol ORF fragment This study
R-p102-Chol CGGCATGACTCCCCGTCAGTATACACTCCGCTAGCGC This study
  1. Relevant restriction enzyme sites are underlined and in italics