Skip to main content

Table 5 Primers used in this work

From: An accurate description of Aspergillus niger organic acid batch fermentation through dynamic metabolic modelling

Primer Nucleotide sequence (5′ to 3′)
pyrG_ex_fw CTTTGCAGGTGTGGCTGAAC
pyrG_ex_rv ACAGCAGTGCTTATCTGCGA
oah_up_fw ACCGCGGTGGCGGCCGCGCTGTGTCCATACCATCAATCC
oah_up_rv GAATGTTGCAGACAGACAGAAAGCAAAAGAGCAGGCAGTAGTAAGCAAGAAT
oah_down_fw TCTTTCTTATTCTTGCTTACTACTGCCTGCTCTTTTGCTTTCTGTCTGTCTGC
oah_down_rv CGGGGGATCCACTAGTTCTCCTCTTCCCCTGCCTTT
gox_up_fw ACCGCGGTGGCGGCCGCGAGATGGCAATTTCCGCGAC
gox_up_rv GAATATTCGAGGATTGTGGGAGAGACAGCGCGTGCAAACTCACCACCAAG
gox_down_fw CTGTCTTGACCTTGGTGGTGAGTTTGCACGCGCTGTCTCTCCCACAATCC
gox_down_rv CGGGGGATCCACTAGTCTACGCTCATGTCCTGGTCC
oah_ex_fw TAAGGCTACCCAACCCACCC
oah_ex_rv GCTTATCTAGGCCCCTGCTG
oah_int_fw ACCCAACCACACCATCCTTC
oah_int_rv ACCCAGTTCCCCACTAACAC
gox_ex_fw CACTATCGCCAAGCAGGGAT
gox_ex_rv AAGGTCTCGTTGAAGGTGGC
gox_int_fw AGCAACCAGCCTTTCCTCTC
gox_int_rv CCCAGTTCCAGCCCTCATTT