Skip to main content

Advertisement

Table 1 Primers used in this study

From: Production of the versatile cellulase for cellulose bioconversion and cellulase inducer synthesis by genetic improvement of Trichoderma reesei

Primers Sequences (5′–3′) Target gene
creF GTACTTTGGCCCTCGCTGAG cre1
creR AGCAATCAGGTGCAGATATCAC cre1
creRUTr CCAGACTGCATAAGGATTCCC cre1
cre1-2426UF GCCAAGACTCAGCATAAA cre1
cre1-1059R GCTAATGATGTCGGTAAGT cre1
cre1-497F GCACTCCTACTCGTCCTT cre1
cre1-UF CCTTCAATGGGGAGGTGG Upstream region of cre1
cre1-UR TGGTGGGTGAGATAGACA Upstream region of cre1
cre1-DF CAGCACAATACGACTCCG Downstream region of cre1
cre1-DR TGCCGAATACCCTGAAAA Downstream region of cre1
DR-F TTGTCCCAGCCCGAGGCATTAG DR fragment
DR-R AGCCGCTGGTCAATGTTATC DR fragment
cre1-F1 GGCGCCTGTGCCAGACTA Δcre1::pyrG cassette
cre1-R1 CAGCACAATACGACTCCG Δcre1::pyrG cassette
pyrG-F CGCCGTCGTGTCTCGTCT A. niger pyrG
pyrG-R ACAGACGGGTATAGGGGTA A. niger pyrG
cbh1-1138UF CCTTTGGCGTTTCCCTGATTC Promotor of cbh1
cbh1-F1 AAAGCGTTCCGTCGCAGTAG Promotor of cbh1
cbh1-R1 AGCACGAGCTGTGGCCAAGAAGG Promotor of cbh1
bglA-F1 CAATAGTCAACCGCGGACTGCGCATCATGAGGTTCACTTTGATCGAGGCG A. niger bglA
bglA-R1 GTGGGTGGAGGGTGCTGGA A. niger bglA
bg-F GTATTACCCCTCCCCTTGG A. niger bglA
bg-R TCGTAGGCGATGTAGTGC A. niger bglA
pyrG-UF1 AATGCTCCGTAACACCCA pyrG+DR fragment
pyrG-2425DR ATCATCGTAACCGAGAATCCA pyrG+DR fragment
cre1-probe-F GGACTTGACACGGGCTAT Probe
cre1-probe-R AGCCATCTCGCAGTGTAT Probe