Skip to main content

Advertisement

Table 2 List of bacterial strains, plasmids, and oligonucleotides

From: Valorization of pyrolysis water: a biorefinery side stream, for 1,2-propanediol production with engineered Corynebacterium glutamicum

Strain, plasmid, or oligonucleotide Relevant characteristics or sequence Source, reference, or purpose
Strains
 Escherichia coli DH5α F Φ80lacZΔM15 Δ(lacZYA-argF) U169 endA1 recA1 hsdR17 (rk, mk+) supE44 thi-1 gyrA96 relA1 phoA [32]
 Corynebacterium glutamicum ATCC 13032 Wild type American-type culture collection
 C. glutamicum Δpqo ΔaceE ΔldhA Δmdh C. glutamicum carrying genetic deletions of the pyruvate:quinone oxidoreductase (pqo), the E1 subunit of the pyruvate dehydrogenase complex (aceE), the lactate dehydrogenase (ldh), and the malate dehydrogenase (mdh) [33]
 PDO1 C. glutamicum + pJULgldA This study
 PDO2 C. glutamicum Δpqo ΔaceE ΔldhA Δmdh + pJULgldA This study
Plasmids
 pJC4   [34]
 pJULgldA pJC4::(P tuf gldA–T rrnB ) plasmid expressing the E. coli glycerol dehydrogenase (gldA) under control of the constitutive C. glutamicum EF-TU promoter (P tuf ) and closed by the E. coli rrnB terminator (T rrnB ) This study
Oligonucleotides 5′ → 3′  
 P1 GACGCCGCAGGG TCTAGACCACAGGGTAGCTGGTAGTTTG Fw primer P tuf (pJC4, Xba I)
 P2 CATGGTATGTCCTCCTGGACTTC Rv primer P tuf
 gldA1 GAAGTCCAGGAGGACATACCATGGACCGCATTATTCAATC Fw primer gldA (P tuf )
 gldA2 CTTCTCTCATCCGCCAAAACAGCAGGCAATTTTGCGTTC Rv primer gldA (T rrnB )
 T1 CTGTTTTGGCGGATGAGAGAAG Fw primer T rrnB
 T2 GATATCCATCACACTG GCGGCCGCAGGAGAGCGTTCACCGACAAAC Rv primer T rrnB (pJC4, Not I)
 seq 1 GATCGACGGTACGCAAC Fw sequencing primer pJULgldA
 seq 2 GGGTGGTAAAGGATGTCG Rv sequencing primer pJULgldA
 seq 3 GCAACCTGGTTTGAAGC Fw sequencing primer pJULgldA
 seq 4 GTGTTCGCTTCAATCACG Rv sequencing primer pJULgldA
  1. For oligonucleotides, the prerequisite homologous region for Gibson assembly (underlined) and restriction sites (bold) are given and refer to the respective features or enzymes named in parenthesis