Skip to main content

Advertisement

Table 2 PCR primers

From: A novel GH10 xylanase from Penicillium sp. accelerates saccharification of alkaline-pretreated bagasse by an enzyme from recombinant Trichoderma reesei expressing Aspergillus β-glucosidase

Primer name Primer sequence
SwaI cbh1 F 5′ CTAGAGTATTTAAATGAGCGGCCGAAGACGG 3′
SwaI cbh1 R 5′ TGCAGGTATTTAAATACCTTATGACAAGAGCT 3′
SwaI pUC F 5′ ATTTAAATACCTGCAGGCATGCAAGCTT 3′
SwaI pUC R 5′ ATTTAAATACTCTAGAGGATCCCCGGGT 3′
amdS F 5′ TGCGCACATCATTGGATAGG 3′
amdS R 5′ TGCGCACTGGAAACGCAACC 3′
cbh1-amdS F 5′ CGTTTCCAGTGCGCAGACCGTCACAAGGGACGCAA 3′
cbh1-amdS R 5′ CCAATGATGTGCGCACTCGGCTACGTTGTCATCGT 3′
Pcbh1 R 5′ GATGCGCAGTCCGCGGTTGA 3′
Tcbh1 F 5′ TAAAGCTCCGTGGCGAAAGCG 3′
Pcbh1-pspxyn F 5′ CGCGGACTGCGCATCATGGTTTGCTTGTCTACCAA 3′
pspxyn-Tcbh1 R 5′ CGCCACGGAGCTTTAAAGACATTGCGAGTACCAAG 3′
SwaI xyn2 F 5′ CTAGAGTATTTAAATTACAAGTCTCCTCTTTC 3′
SwaI xyn2 R 5′ TGCAGGTATTTAAATTCACGCCTACGCTCCCAA 3′
SwaI pyr4 F 5′ CTAGAGTATTTAAATGCCTCTTCTTTGTGCTTTTCT 3′
SwaI pyr4 R 5′ TGCAGGTATTTAAATATATGGAAGCTGATATCGTCG 3′
xyn2-pyr4 F 5′ ACAACGAGAAAAGAAGGACCCTGGGGCAGGTTGCA 3′
xyn2-pyr4 R 5′ ATATCTGGTGGATCTAGGGGGCTCTTCTTTTGTGA 3′
pyr4 F 5′ TTCTTTTCTCGTTGTCTCACTCT 3′
pyr4 R 5′ AGATCCACCAGATATGTCAGGA 3′
Pxyn2 R 5′ GTTGATGTCTTCTTGCTTCA 3′
Txyn2 F 5′ TAAAGGGGGCTCTTCTTTTG 3′
Pxyn2-pspxyn F 5′ CAAGAAGACATCAACATGGTTTGCTTGTCTACCAA 3′
pspxyn-Txyn2 R 5′ GAAGAGCCCCCTTTAAAGACATTGCGAGTACCAAG 3′