Skip to main content

Table 3 Primers for expression, disruption, and complementation of the hno gene

From: Green route to synthesis of valuable chemical 6-hydroxynicotine from nicotine in tobacco wastes using genetically engineered Agrobacterium tumefaciens S33

Primers Sequence (5′–3′)
hno-F CGGGATCCGATGACAGAAAAGATATATGATGC (BamHI)a
hno-R CCCAAGCTTTTAAGCGGTCGCCTTC (HindIII)a
Primer A CGCGGATCCATGACAGAAAAGATATATGATGC
Primer B TCGATAAATGCGCGCTTTTAGGCTAGCTGCAACTCGTTC
Primer C AAAAGCGCGCATTTATCGAACACGCCGAGATGGCTGAC
Primer D GCCGGGCCCTTAAGCGGTCGCCTTC
Primer F2 GCCGGGCCCCATGACAGAAAAGATATATGATGC (ApaI)a
Primer R2 CGCGGATCCTTAAGCGGTCGCCTTC (BamHI)a
  1. aThe restriction site is underlined