Skip to main content

Advertisement

Table 4 Sequences of the oligonucleotide primers used in this study

From: Expressing accessory proteins in cellulolytic Yarrowia lipolytica to improve the conversion yield of recalcitrant cellulose

Primer names Sequence (5′–3′), 15-bp homologous sequence for infusion is underlined
F1 GTTCTCCAGAAGCGACATGGACATATTAATGACATTGTCATCAACG
R1 CACAGACACCCTAGGCTAGTTAAGGCACTGGGCGTAGTAGGG
F2 GTTCTCCAGAAGCGACAGACCATCCAGCCCGGCACC
R2 CACAGACACCCTAGGTTAGCTCACGGTGATAGAGGCAGAGCCA
JMP1F CCTAGGGTGTCTGTGGTATCTAAGCTATT
JMP1R TCGCTTCTGGAGAACTGCGG
F3 ACACCCGAAGGATCCCACAATGAAGCTTTCCACCATCC
R3 ATGGTGATGATGGTGGCTCACGGTGATAGAGGCAGAG
R4 ATGGTGATGATGGTGGTTAAGGCACTGGGCGTAGTAGGG
R5 ATGGTGATGATGGTGGTTCTGGGAAAACTGGACGCC
JMP2F CACCATCATCACCATCATTAAAACT
JMP2R GGATCCTTCGGGTGTGAGTTG
HphF CCACACACATCCACAATGAAAAAGCCTGAACTCACCGCGA
HphR TAGCAGGGCAGGGCCCTATTCCTTTGCCCTCGGACGAGTG
LHFF GGCCCTGCCCTGCTAATGAAATG
LHFR TGTGGATGTGTGTGGTTGTATGTGTGATG
XLF GCTCTAGACGATGCCGCCGCAAGGAATG (XbaI)
XLR CGTCTAGATGGAATTCGATTTGTCTTAGAGGAACGCA (XbaI)