Skip to main content

Table 3 Primers used in this work

From: Lipopeptide produced from Bacillus sp. W112 improves the hydrolysis of lignocellulose by specifically reducing non-productive binding of cellulases with and without CBMs

Type Sequence (from 5′ to 3′) Restriction enzyme
45818-WT Forward CGCGGATCCACACTGCAGTCTAATCTGGTTGTAA Bam
Reverse CCGCTCGAGTTAAATTTCTGTTCCGCCGTAAGTA XhoӀ
45818-Core Forward CGCGGATCCAAAGAGGAAAATGACATCGTTCC Bam
Reverse CCGCTCGAGATGAGTTACTTTAATGCCATTTGTA XhoӀ