Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primers used for amiRNA-D1 and psbA gene expression detections by qRT-PCR

From: Improved photobio-H2 production regulated by artificial miRNA targeting psbA in green microalga Chlamydomonas reinhardtii

Name Primer Sequence (5′ → 3′)
psbA quantification
 D1-F Forward primer CGGTAATCGGTATTTGGT
 D2-R Reverse primer GCACGGTTGATGATGTCT
 Actin-F Forward primer ACCCCGTGCTGCTGACTG
 Actin-R Reverse primer ACGTTGAAGGTCTCGAACA
amiRNA-D1 quantification
 miRNA-D1-F Forward primer TGTCGGTATGTTGCAGTAAGA
 RT-amiRNA-D1 Primer for reverse-transcription GTGCAGGGTCCGAGGTCAGAGCCACCTGGGCAATTTTTTTTTTTCTGTCT
 U4-F Forward primer CGGCGCAAAAGGCCCGACAGAAAT
 RT-U4 Primer for reverse-transcription GTGCAGGGTCCGAGGTCAGAGCCACCTGGGCAATTTTTTTTTTTATTTCTC
 Universal R Universal reverse primer CAGTGCAGGGTCCGAGGT