Skip to main content

Table 3 Universal and specific primers of β-glucosidase genes for real-time quantitative PCR

From: The structural and functional contributions of β-glucosidase-producing microbial communities to cellulose degradation in composting

Primer Sequences (5′–3′) Primer Sequences (5′–3′)
GH1 family genes (bacteria) Microbacterium
 GH1BF CCT ACC AGA TYC ARG G  GH1B-d1F ACGACCATTGACCAGACGGGAGT
 GH1BR GAG GAA GRT CCC ART G  GH1B-d1R GAAGGAGCGGCTGACGAGGAC
Bacillus sp. GH3 family genes (fungi)
 GH1B-a1F AGATTGAAGGAGCAAGGAATGAGG  GH3EF GGT GGT CGC RRY TGG GA
 GH1B-a1R AGGAAGGTCCCAGTGGTAGAGC  GH3ER CCA GGC ATC GGW CAT RTC
Devosia sp. Aspergillus niger
 GH1B-b1F ACCAGAACGAAGGCGGGCAGAC  GH3E-d3F GGCAAGGCTATGGGTCAG
 GH1B-b1R CCAGTCATAGAGCGTGGAGTAG  GH3E-d3R CCAGCGGAAATGCTCTAAT
Streptomyces sp. Penicillium
 GH1B-c1F CGAGCATACACTGGGCAACA  GH3E-e3F TATGGGTGGTGATGTGAAT
 GH1B-c1R GAAGGTTVVAATGGCACAGCGT  GH3E-e3R CAAGTGGCTGGTTGAGTT
\