Skip to main content

Table 2 Primers used in this study

From: Engineering and application of synthetic nar promoter for fine-tuning the expression of metabolic pathway genes in Escherichia coli

Primer name Sequence (5′–3′)
For cloning
 XmaI-SNPL-gfpm-F TCCCCCCGGGCTCTTGATCGTTATCAAATCCCANNNNNNNNNNNNNNNGTATAATGCCCTTAAAAGGAGGATTACAAAATGAGTAAAGGAGAAGAACT
 SphI-gfpm-R ACATGCATGCTTAGTGGTGGTGGTGGTGGTGTTTGTAGAGCTCATCGATGC
 XmaI-gfpm-F TCCCCCCGGGAGGAGGATTACAAAATGAGTAAAGGAGAAGAACTTTT
 NotI-gfpm-R TAAGAATGCGGCCGCTTAGTGGTGGTGGTGGTGGTGTTTGTAGAGCTCATCGATGC
 ldhD-citreum-F-XbaI CTAGTCTAGAAGGAGGATTACAAAATGAAGATTTTTGCTTATGGT
 ldhD-citreum-R-NotI TTCCCTTGCGGCCGCTTAATACTTTACAGCAATACTT
 ilvB-EC-F-XbaI CTAGTCTAGAAGGAGGATTACAAAATGGCAAGTTCGGGCA
 ilvN-EC-R-NotI TTCCCTTGCGGCCGCTTACTGAAAAAACACCGCGAT
 aldB-LL-F-XbaI CTAGTCTAGAAGGAGGATTACAAAATGACAGAAATCACACAACTT
 aldB-LL-R-NotI TTCCCTTGCGGCCGCTCATTCAGCTACATCGATATC
 bdh1-SC-F-XmaI TCCCCCCGGGAGGAGGATTACAAAATGAGAGCTTTGGCATATTTC
 bdh1-SC-R-NotI TTCCCTTGCGGCCGCTTACTTCATTTCACCGTGATT
 SphI-pUC-F ACATGCATGCCCGACTGGAAAGCG
 SphI-pUC-R ACATGCATGCCGGTGTGAAATACCG
 PstI-pUC-F AAAACTGCAGCCGACTGGAAAGCG
 BamHI-pUC-R CGGGATCCCGGTGTGAAATACCG
 PnarS-R TCTCTAACACAGTATTGGGATTTGATAACGATCAAG
 PnarI-R AATCTAGTAACCCGATGGGATTTGATAACGATCAAG
 PnarW-R GGAGATGTTACAATATGGGATTTGATAACGATCAAG
 -10Pnar-F GTATAATGCCCTTAAATCTAGA
 pUCN-ori-fr AGGAAGCGGAAGAGCG
 pUCN-ori-r GAAGATCCTTTGATCTTTTCTA
 pET-ori-R TTGAGATCCTTTTTTTCTGC
 pET-rop-F GGTGCGCATGATCGTG
 pSTVM2-pUC-sub-USER-3-F AGACAGUCATAAGTGCGG
 pSTVM2-pUC-sub-USER-1-R ATGCAACUCGTAGGACAG
 pUC-sub-USER-1-F AGTTGCAUCCCGACTGGAAAGCG
 pUC-sub-USER-2-F ATCCATGUCCCGACTGGAAAGCG
 pUC-sub-USER-5-F ATATGCGAUCCCGACTGGAAAGCG
 pUC-sub-USER-2-R ACATGGAUATGCGGTGTGAAATACC
 pUC-sub-USER-5-R ATCGCATAUATGCGGTGTGAAATACCG
 pUC-sub-USER-3-R ACTGTCUATGCGGTGTGAAATACCG
For qRT-PCR
 q-cysG-F TTGTCGGCGGTGGTGATGTC
 q-cysG-R ATGCGGTGAACTGTGGAATAAACG
 q-gfpm-F AGAGGGTGAAGGTGATGCCA
 q-gfpm-R AGATGATCCGGATAACGCGC
  1. Italic and underline letters represent a restriction enzyme site