Skip to main content

Table 1 Primer sequences used in this study

From: Switchgrass (Panicum virgatum L.) promoters for green tissue-specific expression of the MYB4 transcription factor for reduced-recalcitrance transgenic switchgrass

Gene Primer Primer Sequence (5′ > 3′) Application
PvLhcb PPvLhcb1-2F CCCCGACCGATGCATCTACA Promoter cloning
  PPvLhcb1-2R* TGAGCCGAAGGAGGGTTGCT Promoter cloning
  5Lhcb1-2-1F CCTGTCACACACACAAGAGATGGC Serial deletion
  5Lhcb1-2-2F GTGAGAATATCTGGCGGCGAGC Serial deletion
  Lhcb1qPCRF2 CTCGCCGACCACCTCACCGAT qRT-PCR
  Lhcb1qPCRR1 CGGAAGACAATGAAGTTGCAGA qRT-PCR
PvPEPC PPvPEPCF CACCGGCACTCTATGCTTAC Promoter cloning
  PPvPEPCR* CTAGCTAGCAGCTGCAGTTG Promoter cloning
  5PEPC-1F CGAGGAGCAGAAGAAGTCAC Serial deletion
  5PEPC-2F GCCACAGATTGACATGAAGTATCAC Serial deletion
  5PEPC-3F GCTCTAGTGTGAACGAAGTTCC Serial deletion
  5PEPC-4F CAGTAGCAGTACGGCAAGTC Serial deletion
  PEPCqPCRF1 CTCATCCTCACCATGAAGGGT qRT-PCR
  PEPCqPCRR1 TGCAGTTGAGGAGCGGAGCGC qRT-PCR
PvPsbR PPvPsbRF GTTGGGCTGGTCTTGATCGT Promoter cloning
  PPvPsbRR* TTGCTGCTGCTTCGATTGCC Promoter cloning
  PsbR-1F ACGCACGGAATCACCTAGCAC Serial deletion
  PsbR-2F CAGCCCTGTATGCATGAAGTCC Serial deletion
  PsbR-3F GTTGGATGGCCTATCTTGTCCGG Serial deletion
  PsbR-4F GAGTCGATGCAGCATCCTCGATC Serial deletion
  PsbR-5F TCCCCAGAGGATAACGTTGCAG Serial deletion
  PsbRqPCRF1 CCTTGTTTACAACACCAGCGCT qRT-PCR
  PsbRqPCRR2 CCCAAGCTGATCTTACATG qRT-PCR
PvUbi1 Ubi1-F CAGCGAGGGCTCAATAATTCCA qRT-PCR
  Ubi1-R TCTGGCGGACTACAATATCCA qRT-PCR
PvMYB4 a MYB4-T-F TCGGCATGCTCCTCGACTTC qRT-PCR
  MYB4-T-R ATCATAGGCGTCTCGCATATCT qRT-PCR
PvMYB4 b MYB4-E-F AGGCCTCGAGATGAAGTGAAAC qRT-PCR
  MYB4-E-R AGCCCAACAAACAAACGAAATT qRT-PCR
  1. qRT-PCR, real-time RT-PCR
  2. *Used as the reverse primers for cloning of the serial deletions and the promoter of each promoter
  3. aPrimers for the transgene
  4. bPrimers for the gene specific (endogenous)