Skip to main content

Advertisement

Table 2 Primers used in this study

From: Enhanced biological fixation of methane for microbial lipid production by recombinant Methylomicrobium buryatense

Primer name Sequence (5′–3′) Description
AP186_pCM433kanT_fwd1 ATGTGCAGGTTGTCGGTGTC For amplifying the backbone of the KanR version of the sucrose counterselection plasmid pCM433 [17]
AP187_pCM433kanT_rev1 TGGTAACTGTCAGACCAAGTTTACTC
AP110_spsKO_UP_Fwd ATTGGTACCATGGATGCATATGCTGCAGCTACGCTGCTCTAAATACCTTG For amplifying flanks to knock out sps (MaGE locus tag MBURv2_130613) using plasmid pAB2
AP111_spsKO_UP_Rev TCTGCTCTCAGTCACGATCGTACTCACTTCAGCTG
AP112_spsKO_DWN_Fwd GAAGTGAGTACGATCGTGACTGAGAGCAGAATTATGACTG
AP113_spsKO_DWN_Rev AGTGAGCTCACCGGTTAACACGCGTACGTACCTTCGGCCAAATACAACGA
  1. Homology regions used for Gibson assembly are underlined