Skip to main content

Advertisement

Table 2 Relevant primers for plasmid construction

From: An engineered fatty acid synthase combined with a carboxylic acid reductase enables de novo production of 1-octanol in Saccharomyces cerevisiae

Primer name Sequence 5′–3′ Amplicon
SHP35_pPGK1_for AACCCTGGCGTTACCCAACTTAATCGCCTTGCAG CATGTTTGCAAAAAGAACAAAACTG PGK1 promotor
CBP160_pPGK1_rev TGTTTTATATTTGTTGTAAAAAGTAGATAATTAC PGK1 promotor
CBP35_tPGM2_for AACGAATGATTTACTAATGGC PGM2 terminator
SHP36_tPGM2_rev GAAATCGGCAAAATCCCTTATAAATCAAAAGAAT AGACAAAAAACTCGGGGTAGGTAAT PGM2 terminator
SHP54_Ahr_for CAAAAACAAAAAGTTTTTTTAATTTTAATCAAAAA ATGTCGATGATAAAAAGCTATGCC Ahr ORF
SHP53_Ahr_rev ATGTAAGCGTGACATAACTAATTACATGACTCGA GTCAAAAATCGGCTTTCAACAC Ahr ORF
DR_Faa2 GGAAGAATGCAGGTTACAAAAAACGGATAAGAA CAAACTTGTTTCGAAATGTACTTATGACGATTTGG AACACATTCAAACTAGAAAAAACTTTGATGTA Donor-DNA fragment for FAA2 deletion
CC_FAA2-rev CGTAAGGTTTCAAAATCTTCGATCATTTATCTTTC ACTGCGGAG Amplification of a CRISPR-Cas9 plasmid pRCCN for deletion of FAA2, reverse
CC_FAA2-fw GAAGATTTTGAAACCTTACGGTTTTAGAGCTAGAA ATAGCAAGTTAAAATAAGG Amplification of a CRISPR-Cas9 plasmid pRCCN for deletion of FAA2, forward
  1. The abbreviations within the primer names were used as follows: forward primer (fw) and reverse primer (rev)