Skip to main content

Table 1 Primers used in expression cassette construction in this study

From: A GFP-fusion coupling FACS platform for advancing the metabolic engineering of filamentous fungi

Primer Sequence Comments
pyr4-cass-F TCTAGATATCGGATCCATCCCGGCTTGCGCTTGGACCTCGC pyr4 expression cassette
pyr4-cass-R ACTAGTAAGCTTCCTAGGATATGGAAGCTGATATCGTCGACAA
TrPDI2-egfp-1F AATCTAGAATGGTCTTGATCAAGAGCCT Trpdi2-gfp segment
TrPDI2-egfp-1R AACAGCTCCTCGCCCTTGCTCACCAGCTCGTCCTTCTGGTCCTCGT
TrPDI2-egfp-2F ACGAGGACCAGAAGGACGAGCTGGTGAGCAAGGGCGAGGAGCTGTT
TrPDI2-egfp-2R ATATGCATTTACTTGTACAGCTCGTCCAT
P19-Ppdc-F CGGTACGCGCGGATCTTCCAGAGATTCTAGATATCCGCTAGCAGGACTTCCAGGGCTACTTGGCGCG pdc promoter
Ppdc-gfp-R TGAACAGCTCCTCGCCCTTGCTCACGTCGACCTTGGGCCCCTGCAGAAGCTTCATGATTGTGCTGTAGCTGCGCTGCTTT
Ppdc-gfp-F AAAGCAGCGCAGCTACAGCACAATCATGAAGCTTCTGCAGGGGCCCAAGGTCGACGTGAGCAAGGGCGAGGAGCTGTTCA gfp
gfp-Tcbh1-R CACTGGCCGTAGTGAGACTGGGTAGCCATGGCTCGAGTTACTTGTACAGCTCGTCCATGCCG
gfp-Tcbh1-F CGGCATGGACGAGCTGTACAAGTAACTCGAGCCATGGCTACCCAGTCTCACTACGGCCAGTG cbh1 terminator
Tcbh1-P19-R GTTTGCACGCCTGCCGTTCGACGATACTAGTCCTAGGTGGCCTCGCAACGGACAAGTTGGTC
P19-Ptef1-F CGGTACGCGCGGATCTTCCAGAGATTCTAGATATCCGCTAGCGGGACAGAATGTACAGTACTATACT tef1 promoter
Ptef1-gfp-R TGAACAGCTCCTCGCCCTTGCTCACGTCGACCTTGGGCCCAAGCTTCATTTTGACGGTTTGTGTGATGTAGCGT
Ptef1-gfp-F ACGCTACATCACACAAACCGTCAAAATGAAGCTTGGGCCCAAGGTCGACGTGAGCAAGGGCGAGGAGCTGTTCA gfp
gfp-Tegl1-R ACGTGCACGTCTTGCACCCGCTGTACTGCAGCTCGAGGTCGACTTACTTGTACAGCTCGTCCATGCCG
gfp-Tegl1-F CGGCATGGACGAGCTGTACAAGTAAGTCGACCTCGAGCTGCAGTACAGCGGGTGCAAGACGTGCACGT egl1 terminator
Tegl1-P19-R GTTTGCACGCCTGCCGTTCGACGATACTAGTCCTAGGTGCATTTCAAGGGCGTTGCTGAGAG
P19-Ppki-F CGGTACGCGCGGATCTTCCAGAGATTCTAGATATCCGCTAGCATAACGGTGAGACTAGCGGCCGGTC pki promoter
Ppki-gfp-R TGAACAGCTCCTCGCCCTTGCTCACGTCGACCTTGGGCCCCTGCAGAAGCTTCATGGTTAAGAGGGTTCTTCCGGCTTCG
Ppki-gfp-F CGAAGCCGGAAGAACCCTCTTAACCATGAAGCTTCTGCAGGGGCCCAAGGTCGACGTGAGCAAGGGCGAGGAGCTGTTCA gfp
gfp-Tcbh2-R TGTTTGAAGCCCGGTCACGAAAGCCCCATGGCTCGAGTTACTTGTACAGCTCGTCCATGCCG
gfp-Tcbh2-F CGGCATGGACGAGCTGTACAAGTAACTCGAGCCATGGGGCTTTCGTGACCGGGCTTCAAACA cbh2 terminator
Tcbh2-P19-R GTTTGCACGCCTGCCGTTCGACGATACTAGTCCTAGGAAGAGGTGGAGTAATTGGAATCTAC
Atfar1-gfp-PstI-F AAGGCCTGCAGATGGAATCCAATTGTGTTCAATTTC Atfar1
Atfar1-gfp-SalI-R AACCTGTCGACTTGTTTAAGCACATGGGTGATGAGG
Atfar6-gfp-PstI-F AAGGTCTGCAGATGTGTTTTTATGGTGAGACGTCTT Atfar6
Atfar6-gfp-SalI-R AACCTGTCGACCTCAGTCTTCTTCTTAGAAAGAAAT
Tafar-gfp-HindIII-F GGCCTAAGCTTATGGTGTCCATCCCCGAGTACTACG Tafar1
Tafar-gfp-SalI-R AACCTGTCGACGTATCGCATGGTGGAAGAGGCTCGA  
Tef1-RT-F GCTCTGCTCGCCTACACCCT Real-time PCR
Tef1-RT-R TCTCCTTCTCCCAGCCCTTG
Tafar1-RT-F CCGACCCAACACCTACAC
Tafar1-RT-R GGTCCGTTAAAGTTGTCAATC