Skip to main content

Advertisement

Table 1 Primers used in the study

From: Production of alkanes from CO2 by engineered bacteria

Name Sequence 5′ → 3′ Description
tl17 TGGAATTCGCGGCCGCTTCTAGAGAAAGAGGAGAAATACTAGATGATATCAATCAGGGAAAAACGCG acr1 forward, biobrick
tl18 GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTACCAGTGTTCGCCTGGG acr1 reverse, biobrick
tl33 CGGCCGCTTCTAGAGAAAGAGGAGAAATACTAGATGAATTACTTCGTCACCGG ramo forward, XbaI
tl34 GGCCGCTACTAGTATTATTACCAATGCTCGCCCTTG ramo reverse, SpeI
0030_Aar TGGAATTCGCGGCCGCTTCTAGAGATTAAAGAGGAGAAATACTAGATGTTTGGTTTAATTGGCCA aar forward, BBa0030, biobrick
0031_Aar TGGAATTCGCGGCCGCTTCTAGAGTCACACAGGAAACCTACTAGATGTTTGGTTTAATTGGCCA aar forward, BBa0031, biobrick
0032_Aar TGGAATTCGCGGCCGCTTCTAGAGTCACACAGGAAAGTACTAGATGTTTGGTTTAATTGGCCA aar forward, BBa0033, biobrick
Aar_rev CTGCAGCGGCCGCTACTAGTATTATTAAATTGCTAAAGCCAGCG aar reverse, biobrick