Skip to main content

Advertisement

Table 4 Oligonucleotides used for PCR amplification

From: Restriction-deficient mutants and marker-less genomic modification for metabolic engineering of the solvent producer Clostridium saccharobutylicum

Primer name Oligonucleotides sequence Function
pCN3_V_F GAAAACTTTTTGCGTGTGACAG pCN3 backbone
pCN3_V_R CTGTCAGACCAAGTTTAC
catp_FpJIR_IV GTAAACTTGGTCTGACAGACCGTATTTCTACGATGTTT catP gene from pJIR750
catp_RpJIR_IV CTGTCACACGCAAAAAGTTTTCTTTCGGCAAGTGTTCAAG
FlankA_F6_IV GATTACAAACGTTGAAGAAGGAAGGAACTGGTCCAGAAG hsdR1 upstream
HsdR1_A_Fu_R CATTTCTTTAGTTCCCTTCTTAATATTTTCCCCCCTACATTC
HsdR1_B_Fu_F GAATGTAGGGGGGAAAATATTAAGAAGGGAACTAAAGAAATG hsdR1 downstream
FlankB_R6_IV CTTGAACACTTGCCGAAAAATGGAGGATTTGCCAATA
pCN6_V_F CTTCTTCAACGTTTGTAATC pCN6/pCN8 backbone
pCN6_V_R TTTCGGCAAGTGTTCAAG
HsdR1_check_F GCAGGAGAAAGGATATGG hsdR1 wild type or mutant
HsdR1_check_R CGATACTCCTGCATATGG
check_preR ACACAACCGGCACAAACC check integration
Check_catp_F AACTATTTATCAATTCCTGCAATTCGTTTAC catP gene on the deletion vector
Check_catp_R ATGGTATTTGAAAAAATTGATAAAAATAGTTG
HsdR2_A_F_IV CTTGAACACTTGCCGAAAGTGTTAGGTTTAAAGAATAC hsdR2 upstream
HsdR2_A_Fu_R GAATAATTAGGAGGGGATTTGATAATAGTTTAATGGCTATTG
HsdR2_B_Fu_F CAATAGCCATTAAACTATTATCAAATCCCCTCCTAATTATTC hsdR2 downstream
HsdR2_B_R_IV GATTACAAACGTTGAAGAAGAAGACTGGGATCGATAGC
pCLcodBA_F_IV CTACTTAATTGTGTGTAAGATAAAGAAGAAGACTGGGATCGAT pChN1 backbone
pCLcodBA_R_IV CATCAATTACCTCCTAAATTAATAATTAGCTAATTTTCGTTTAATTAT
CLcodBA_F2 AATTATTAATTTAGGAGGTAATTGATG codBA gene from C. ljungdahlii
CLcodBA_R2 TTATCTTACACACAATTAAGTAG
HsdR2_check_F GGTGGTTCTACAGCAATCTC hsdR2 wild type or mutant
HsdR2_check_R GCTAAGGACGTTGGATTAGC
pChN_backbone_F TACTTAATTGTGTGTAAGATAAGTTTCGGCAAGTGTTCAAGAAG pChN backbone
pChN_backbone_R CTTATCTTACACACAATTAAGTAGAAGAAC
HsdR3_A_F_IV GTTCTTCTACTTAATTGTGTGTAAGATAAGTGTCTATTCAAGTGCTGTGG hsdR3 upstream
HsdR3_A_R_IV GAAATACAGGGGGTGTTAAC GCTTACAAGACCACAACTAG
HsdR3_B_F_IV CTAGTTGTGGTCTTGTAAGC GTTAACACCCCCTGTATTTC hsdR3 downstream
HsdR3_B_R_IV CTTCTTGAACACTTGCCGAAA GCTGCAATAGCAAAATATCG
pChN_V_F TTTCGGCAAGTGTTCAAGAAG pChN2/pChN3/pChN4 backbone
pChN_V_R CTTATCTTACACACAATTAAGTAGAAGAAC
HsdR3_check_F TGCTAAAGTATCGCGGTTGTC hsdR3 wild type or mutant
HsdR3_check_R AGCCGTTCTGAAATTGAACTG
codBA_CL_R TATGTGGATGGGGAAGAG Check integration
xylB_A_F_IV ACTTAATTGTGTGTAAGATAAG CTAATCCATCCGTTATTG xylB upstream
xylB_A_fu_R2_IV GTTTATTGATGAGGTATT CTTATCCTAGAATTAAAG
xylB_B_fu_F2_IV CTTTAATTCTAGGATAAG AATACCTCATCAATAAAC xylB downstream
xylB_B_R_IV CTTGAACACTTGCCGAAA TTATTAGATGCTTCTTAG
xylB_check_F ATTCTCCCGATGAATTATTG xylB wild type or mutant
xylB_check_R TCCTTCGTTCAATTAAATC
PTB_F_IV TTAATTGTGTGTAAGATAAG ATAAAGCGCCAGTACAGC ptb upstream
PTB_R2_fu_IV CTTTAGCTTCTTCTTCTCCA TCCTTTAATCTTGATAG
BUK_R_IV CTTGAACACTTGCCGAAA ACCTAGTACTCCCTGTTC buk downstream
BUK_F2_fu_IV CTATCAAGATTAAAGGA TGGAGAAGAAGAAGCTAAAG
PTB_check_F3 CGGCATTAGTTGTAACTG Ptbbuk wild type or mutant
BUK_check_R2 GCTCCACTTGCATTCATC