Skip to main content

Table 4 Oligonucleotides used for PCR amplification

From: Restriction-deficient mutants and marker-less genomic modification for metabolic engineering of the solvent producer Clostridium saccharobutylicum

Primer name Oligonucleotides sequence Function
HsdR1_check_F GCAGGAGAAAGGATATGG hsdR1 wild type or mutant
check_preR ACACAACCGGCACAAACC check integration
Check_catp_F AACTATTTATCAATTCCTGCAATTCGTTTAC catP gene on the deletion vector
HsdR2_check_F GGTGGTTCTACAGCAATCTC hsdR2 wild type or mutant
HsdR3_check_F TGCTAAAGTATCGCGGTTGTC hsdR3 wild type or mutant
xylB_check_F ATTCTCCCGATGAATTATTG xylB wild type or mutant
PTB_check_F3 CGGCATTAGTTGTAACTG Ptbbuk wild type or mutant