Skip to main content

Advertisement

Table 2 Primers used in this study

From: Genome mining of 2-phenylethanol biosynthetic genes from Enterobacter sp. CGMCC 5087 and heterologous overproduction in Escherichia coli

Primers Nucleotide sequencea
pETDuet-kdc0498-F CGCggatcctATGAATCACATGAATAAAC
pETDuet-kdc0498-R CCCaagcttATGCGCTTGTAAGACC
pETDuet-kdc0505-F CGCggatcctGTGGCAAAAGTGGAACCCG
pETDuet-kdc0505-R cgaattcTCATGCCATCCCCTTCGC
pETDuet-kdc1244-F CGCggatcctATGAAACGACTCATTGTTGG
pETDuet-kdc1244-R CCCaagcttCAGGCCCCTTGCCAGCG
pETDuet-kdc1476-F CGCggatcctATGAACACCTTCGACAAAC
pETDuet-kdc1476-R CCCaagcttACAGGTTATCTGGAAAG
pETDuet-kdc3074-F CGCggatcctATGACGGGGGCAACGGGC
pETDuet-kdc3074-R CCCaagcttCAAATGCCATCTTTATTCTC
pETDuet-kdc3075-F CGCggatcctATGGCATTTGATGATTTGAG
pETDuet-kdc3075-R cagagctcTTATTGACGTGCTGCCAGC
pETDuet-kdc3076-F CGCggatcctATGATTTGTCCACGTTGTGC
pETDuet-kdc3076-R CCCaagcttACAGCAGCGGCGGGATTG
pETDuet-kdc3652-F CGCggatcctATGATTAAATCATTAACGTCC
pETDuet-kdc3652-R cgaattcTCAATCTGCGGAAATGGC
pETDuet-kdc4427-F CGCggatcctATGCGTACCCCATACTGC
pETDuet-kdc4427-R ATAAGAATgcggccgcCAGGCGCTATTGCGCGC
pETDuet-ARO10-F CGCggatcctATGGCACCTGTTACAATTG
pETDuet-ARO10-R cagagctCTATTTTTTATTTCTTTTAAGTG
pACYC-ADH2-F catcagatctccatcaccatcatcaccacATGTCTATTCCAGAAACTC
pACYC-ADH2-R cggggtaccTTATTTAGAAGTGTCAAC
pACYC-adh4428-F GAagatctCATGGGTTATCAGCCGGACA
pACYC-adh4428-R CCGctcgagTTATTTTGAGCTGTTCAGGATTG
pheA3272-F GA agatctc ATGACACCGGAAAACCCGTTAC
pheA3272-R CCGctcgag TTAGGCCGGGTCAACCG
pheA3270-F GA agatctc ATGGTTGCTGAATTGACCG
pheA3270-R CCGctcgag TTACTGGCGACTGTCATTTG
aroG1710-F GCggatcctATGAATTATCAGAACGACGATTTACGCAT
aroG1710-R ATAAGAATgcggccgcTTAGCCGCGACGCGCTTTTA
aroH2193-F GCggatcctATGAATAAAACCGATGAACTCCG
aroH2193-R ATAAGAATgcggccgcTTAGAAGCGAGAATCAACCG
aroF3269-F GCg gat cct TTGAGGAAAACAACTATCGCA
aroF3269-R ATAAGAATgcggccgc TTAAGCCAGACGCGTCG
ppsAtktA-F TCCGctcgagTTAAGGAGGTATATATTAATGTCCAACAATGGCTCGT
ppsAtktA-R TCCGcctaggTTACAGCAGTTCTTTTGCTTTCG