Skip to main content

Advertisement

Table 1 Strains, plasmids and primers used in this study

From: Simultaneous consumption of cellobiose and xylose by Bacillus coagulans to circumvent glucose repression and identification of its cellobiose-assimilating operons

Designation Relevant characteristics Source or reference
Strains
 B. coagulans NL01 Undomesticated wild strain Laboratory preservation
 B. coagulans ATCC 7050 Undomesticated wild strain American Type Culture Collection
 B. coagulans XZL4 Undomesticated wild strain Professor Ping Xua
 B. coagulans ATCC 7050 (ΔcelR) celR deletion strain of B. coagulans ATCC 7050 This study
 L. lactis MG1363 Host for gene cloning Laboratory preservation
 E. coli BL21(DE3) Host for protein expression Invitrogen
 E. coli BL21 (pET-celo1) E. coli BL21(DE3) harboring the plasmid pET-celo1 This study
 E. coli BL21 (pET-celo2) E. coli BL21(DE3) harboring the plasmid pET-celo2 This study
 E. coli BL21 (pETDuet-1) E. coli BL21(DE3) harboring the plasmid pETDuet-1 This study
Plasmids
 pMH77 pSH71 replication containing temperature-sensitive vector, Cmr Professor Oscar P. Kuipersb
 pMD-19T Gene cloning vector, Ampr TaKaRa
 19T-celR1 pMD-19T containing the flanking regions of celR This study
 pMH77-celR1 pMH77 containing the flanking regions of celR This study
 pETDuet-1 Protein expression vector, Ampr Novagen
 pET-celo1 pETDuet-1 containing the CELO1 from B. coagulans NL01 This study
 pET-celo2 pETDuet-1 containing the CELO2 from B. coagulans NL01 This study
Primers Sequences (5′ → 3′) and properties  
 celR1up.f GATCCGGAATTCCCACACAAAGGGAAATTACGTAAGCCAC (EcoRI) This study
 celR1up.r GTAAATGGCGGCGGCACTGAGCTCATGCCAACAACTCCCTTTTATCATTG This study
 celR1down.f CAATGATAAAAGGGAGTTGTTGGCATGAGCTCAGTGCCGCCGCCATTTAC This study
 celR1down.r CATCCGCTCGAGCAATATCATCCAGTTTCACCATATTCGG (XhoI) This study
 celo1.f AGATCTCTTGAACATAGAAGAAATCAGTTTTC (BglII) This study
 celo1.r GGTACCTTATTTTATACATGCCATTAACTCAT (KpnI) This study
 celo2.f GAGCTCGTTGATTTCGAATCGGCAAAAAC (SacI) This study
 celo2.r CTCGAGTTAAGCAATGCTATCCTTCGTCGT (XhoI) This study
  1. aFrom State Key Laboratory of Microbial Metabolism, Shanghai Jiao Tong University, People’s Republic of China
  2. bFrom Groningen Biomolecular Sciences and Biotechnology Institute, Department of Genetics, University of Groningen, Netherlands