Skip to main content

Table 2 Primers used for PCR amplification, sequencing and determination of gene location

From: Improved lipid production via fatty acid biosynthesis and free fatty acid recycling in engineered Synechocystis sp. PCC 6803

Name Sequences
UPAar_F 5′-AGATCTAGGGACGGAACAAACCCTCCAAAGC-3′
UPAar_R1 5′-GAAGATCCTTTGATTTTGCCGACAGGATAGGGCGTGTGTGGA-3′
UPAar_R2 5′-GAATTCAAAAAAAGGATCTCAAGAAGATCCTTTGATTTTGCCGACAGGA-3′
DWAar_F 5′-GGATCCCATTGATAATAGTCAGAATAAATAG-3′
DWAar_R 5′-GTCGACCCTTTAGTAGCTCTTTAGGGGTTAA-3′
UPlipA_F 5′-TAGAGAAGATCT CAGGCCCTACGTCGTCATAATCCTG -3′
UPlipA_R1 5′-GAAGATCCTTTGATTTTGTGGATTGGAAAGGGATTAGTCTTC-3′
UPlipA_R2 5′-TAGAGAGAATTCAAAAAAAGGATCTCAAGAAGATCCTTTGATTTTGTGGATTGGA-3′
DWlipA_F 5′-TAGAGAGGATCCTAGGTTCTACAAACTCAGCAAACGG-3′
DWlipA_R 5′-TAGAGAGTCGACAGGTCAACCAAGATTCGGTGCACCA-3′
AccA_F 5′-TCTAGATAGTGGAGGTACTAGAATGAGTAAAAGTGAGCGTCGTG-3′
AccA_R 5′-CTGCAGCGGCCGCTACTAGTTTACACCGCCGTTTCTAAAAATTG-3′
AccB_F 5′-TCTAGATAGTGGAGGTACTAGAATGGACTACAAGGATGACGATGACAAG-3′
AccB_R 5′-CTGCAGCGGCCGCTACTAGTCTAGGGTTTAATCCACATTAGGG-3′
AccC_F 5′-TCTAGATAGTGGAGGTACTAGAATGCAATTCGCCAAAATTTTAATTGCC-3′
AccC_R 5′-CTGCAGCGGCCGCTACTAGTCTAGGGTGTTAAATGCTCTTCG-3′
AccD_F 5′-TCTAGATAGTGGAGGTACTAGAATGTCTCTATTTGATTGGTTTG-3′
AccD_R 5′-CTGCAGCGGCCGCTACTAGTTTAACCATCTTGATTGACGGAAA-3′
UUPPsbA2_SF 5′-GTGATGCCTGTCAGCAAAACAACTT-3′
Aas_F3 5′-AGACAATCTAGAGTGGACAGTGGCCAT-3′
Aas_R5 5′-GGAGATGGTTCAAGCTCAGG-3′
Aas_F4 5′-ACTCCCTAGAAAGAAGCGCC-3′
Aas_R6 5′-ATAAACACTAGTTTAAAACATTTCGTC-3′
Aas_SR 5′-GGCTATTCCAATGGATTTGAGGTTG-3′
Cm_SF 5′-GGCAGAATGCTTAATGAATTACAACAG-3′
Cm_SR 5′-CTGAAATGCCTCAAAATGTTCTTTACG-3′
UUPF_Aas 5′-GCGATCGCCGTCAATTTTCGATCAG-3′
pE_SF 5′-CATTACGCTGACTTGACGGG-3′
pE_SR 5′-AGGTATGTAGGCGGTGCTAC-3′
UUPF_LipA 5′-ACAGGGCCAGGTGGGAGAAATTTTG-3′
AccA_SR 5′-CTACCGGCCAATCAAGTTTGCAC-3′
UUPF_Aar 5′-CAAAAGTAATGAGGTCGTTTTACCC-3′
CUPAar_SF 5′-CTACCGGCCAATCAAGTTTGCAC-3′