Skip to main content

Table 1 Sequences of the oligonucleotide primers used in this study

From: Nitric oxide increases biofilm formation in Saccharomyces cerevisiae by activating the transcriptional factor Mac1p and thereby regulating the transmembrane protein Ctr1

Primer name Primer sequence Source
MAC1-up-F AATGGGAACAAATATGCGTGTGCATCGTGCATCAG This work
MAC1-up-R GCCTCCATGTCCGTATAGGCTCCTGTTGAAGCC This work
MAC1-dn-F GCTGGTCGCTATACTGTCCTTGGAATCTACGTC This work
MAC1-dn-R ATCCGGAGGACATATGCATTCCTTGTCAGTGCATTTAC This work
G418-MAC1-F GGAGCCTATACGGACATGGAGGCCCAGAATAC This work
G418-MAC1-R CGTAGATTCCAAGGACAGTATAGCGACCAGCATTCAC This work
CTR1-up-F GATGTCTAGTGCCAGCAAAACGATATTATCG This work
CTR1-up-R CCTCCATTGTCTGGAGTTTGCTGAAGGTAAA This work
CTR1-dn-F CTGGTCGCTATACTGGACACAGAGAATAATT This work
CTR1-dn-R GTTATGAGTGAATTTTTCGGCCGGAAG This work
G418-CTR1-F AAACTCCAGACATGGAGGCCCAG This work
G418-CTR1-R AATTATTCTCTGTGTCCAGTATAGCGACCAGC This work
CTR3-up-F TATGGGAGGCAGTAGCAGCACTGCT This work
CTR3-up-R CTGGGCCTCCATGTCAAAGCCTTGTAGTTC This work
CTR3-dn-F CGCTATACTGTACAACGAACCAAGCTGGAA This work
CTR3-dn-R ACAAGCAGCATTTGCGATCATCACTCTCT This work
G418-CTR3-F TACAAGGCTTTGACATGGAGGCCCAGAAT This work
G418-CTR3-R CAGCTTGGTTCGTTGTACAGTATAGCGACC This work
FRE1-up-F CGGTTCAATCGAGTGCTACACTTATTAGC This work
FRE1-up-R CTGGGCCTCCATGTCTCAAGATAGTGGCTGCAG This work
FRE1-dn-F GGTCGCTATACTGTGGTAAGAACATCATGG This work
FRE1-dn-R AACGGCCAACATGAAACAAACGTAGGC This work
G418-FRE1-F CCACTATCTTGAGACATGGAGGCCCAGAA This work
G418-FRE1-R TGATGTTCTTACCACAGTATAGCGACCAGC This work
FRE7-up-F TATTGCTGACATCCACTCCGAACTATACGC This work
FRE7-up-R GGCCTCCATGTCGGTCTGTAGAATGGA This work
FRE7-dn-F TCGCTATACTGCGCCTTTGTCTGTTCG This work
FRE7-dn-R ACCAAACCACAATTGTAGCAACCAGATAC This work
G418-FRE7-F ATTCTACAGACCGACATGGAGGCCCAGAATA This work
G418-FRE7-R CAGACAAAGGCGCAGTATAGCGACCAG This work
IRC7-up-F CGCAACTGTCTGTTATTGGACGTAATCCAG This work
IRC7-up-R GCCTCCATGTCCCTATTGATGGGTCATAA This work
IRC7-dn-F CTGGTCGCTATACTGGTTAAGCCAAATACAAC This work
IRC7-dn-R AACCCAGTATTCATGTCCGGGACAATCTTC This work
G418-IRC7-F ACCCATCAATAGGGACATGGAGGCC This work
G418-IRC7-R TTGTATTTGGCTTAACCAGTATAGCGACCAG This work
REE1-up-F GAATACTGAATTATCGCAAGGAACATGGCT This work
REE1-up-R CTGGGCCTCCATGTCCCATCAGAAATTTC This work
REE1-dn-F GGTCGCTATACTGTTTTGACAAATGGAAAATCAG This work
REE1-dn-R CAAATCATGTAAAGCTTTTCCTAAAGGAGCTG This work
G418-REE1-F AATTTCTGATGGGACATGGAGGCCCAG This work
G418-REE1-R TTCCATTTGTCAAAACAGTATAGCGACC This work
pAurR-MAC1-F TTCAGTTAGCTAGCATGATAATATTTAATG This work
pAurR-MAC1-R GTGCCACCTGACGTCTTATGAAGTGGTGGCA This work
pAurR-CTR1-F TTCAGTTAGCTAGCATGGAAGGTATGAATAT This work
pAurR-CTR1-R GTGCCACCTGACGTCTTAGTTATGAGTGAA This work
pAurR-CTR3-F TTCAGTTAGCTAGCATGAATATGGGAGGCAGT This work
pAurR-CTR3-R GTGCCACCTGACGTCTTAGTTATGAGTGAA This work
pAurR-FRE1-F TTCAGTTAGCTAGCATGGTTAGAACCCGTGT This work
pAurR-FRE1-R GTGCCACCTGACGTCTTACCATGTAAAACTTTC This work
pAurR-FRE7-F TTCAGTTAGCTAGCATGATTGAAGAAAGAG This work
pAurR-FRE7-R GTGCCACCTGACGTCCTAGTAGCCAAAACTCTCG This work
pAurR-IRC7-F TTCAGTTAGCTAGCATGATTGATCGTACCGAGTTA This work
pAurR-IRC7-R GTGCCACCTGACGTCCTAGCCACCCCATGAAATCCC This work
pAurR-REE1-F TTCAGTTAGCTAGCATGGTCGAATCTAAGAA This work
pAurR-REE1-R GTGCCACCTGACGTCCTAACTCAAATCATGTAAAG This work