Skip to main content

Table 2 Genes and primers used for quantitative real-time PCR

From: Nitric oxide increases biofilm formation in Saccharomyces cerevisiae by activating the transcriptional factor Mac1p and thereby regulating the transmembrane protein Ctr1

Gene Forward primer sequence (5′–3′) Reverse primer sequence (5′–3′)
MAC1 TGCTGCAGCGCAATGAA TCTAACAGCAGAGGCACGTACAA
CTR1 CGGTAACTGCCAATGTGGTAGA ATCGGCAACAGCAATTGGAT
CTR3 CGGCTGTTTTGCGCTTGT TCAAATTGCCTTGAAAAACGAGTA
FRE1 AATGGTCTGCCTACGTTTGTTTC CGAGGCGGTCATGACAATT
FRE7 TGGCCTCGACCATTGCA GACGATCAATTCTACGCATCCTT
IRC7 GGCTCGGAAATCGAGATGAG TCCGGGACAATCTTCAAAGG
REE1 TCCATTTCCAACTTCTGACCATT CCACGCTCAGGTGTGCAA
FLO11 ACTTTGGATGTGACTTCCGTTTC ACCTTTGACATGAATAGTGATTTGGTA
18S ACGGAGCCAGCGAGTCTAAC CGACGGAGTTTCACAAGATTACC