Skip to main content

Advertisement

Table 2 The nucleotide sequences of synthetic RBS with different translation initiation rates based on the prediction using RBS calculator (https://salislab.net/software/forward)

From: Prediction and characterization of promoters and ribosomal binding sites of Zymomonas mobilis in system biology era

Name Strength Predicted RBS sequence (5′–3′)
ZM4-Ptet-GFP-10 10 CCATAATCTAGAGAAAGTAAGCAC
ZM4-Ptet-GFP-1000 1000 AGGCTAAGAACTAACGGAGAGGTAAAT
ZM4-Ptet-GFP-10000 10,000 ATCACAGGGTCTAGAAGGAGGTCGAA
ZM4-Ptet-GFP-Max 15,000 GAGCGAGAAGGAGGTAAAGT