Skip to main content

Table 2 Primers and their sequences used for PCR in this study

From: Systematic unravelling of the inulin hydrolase from Bacillus amyloliquefaciens for efficient conversion of inulin to poly-(γ-glutamic acid)

Primers Sequences (5′–3′)
pETSACC-F CAGCAAATGGGTCGCGGATCCATGGCACCAAAATGGCCC
pETSACC-R GTGGTGGTGGTGGTGCTCGAGCTAAGGATGAATCGAACCGAGAT
pETCSCA-F CAGCAAATGGGTCGCGGATCCATGGATAGAATTCAGCAGGCGG
pETCSCA-R GTGGTGGTGGTGGTGCTCGAGTCACTTTTTTTCCAAATGTCCTTTAC
D37A-1 CTTAAACTGAATAAGTCCGTTCGGCGCATTGATCCAATTCGCCCGGG
D37A-2 TTCAAAGAAATCAGGACACGCCCACATATAGCCGAGATG
D161A-1 TTCAAAGAAATCAGGACACGCCCACATATAGCCGAGATG
D161A-2 GGTCATCTCGGCTATATGTGGGCGTGTCCTGATTTCTTTGAATTA
E215A-1 GCGATGCTTCCACACTTTCGGCGCGCGAAAATGGCGGGAGCT
E215A-1 AGCTCCCGCCATTTTCGCGCGCCGAAAGTGTGGAAGCAT
pNXCSCA-F AAAAGGAGCGATTTAGGTACCATGGATAGAATTCAGCAGGCGG
pNXCSCA-R TGTTTTTTTATTACCCATATGTCACTTTTTTTCCAAATGTCCTTTAC
pDRCSCA’-F TAGATAGCGCATGCTGAATTCCCGCCGGAAGACAGCTCC
pDRCSCA’-R ACATACTTTAAAAATCTCGAGCGCACTCTTCTCACACCGTCT
CSCAOUT-F CCATGACCGAGGATTTGCGGACAATG
CSCAOUT-R TGGACCGCTCCTGCAGTACAACGTCT