Skip to main content

Table 3 PCR primers designed and used in this study with the relevant restriction sites underlined (XhoI = ctcgag, BamHI = ggatcc, BglII = agatct)

From: Construction of industrial Saccharomyces cerevisiae strains for the efficient consolidated bioprocessing of raw starch

Primer name Sequence (5′-3′)
ENOCASS-L gtgcggtatttcacaccgcataggagatcgatcccaattaatgtgagttacctcactc
ENOCASS-R cgggcctcttcgctattacgccagagcttagatct
amdSYMCas-L ccgcgcgttggccgattcattaatccaggatccacatggaggcccagaataccctccttgac
amdSYMCas-R gggcctcttcgctattacgccagagcttagatctcagtatagcgaccagcattcacatacttaa
Delta-ENO1_Promoter-L tggaataaaaatccactatcgtctatcaactaatagttatattatcaatatattatcatatacggtgttaagatgatgacataagttatgagaagctgtcggatcccaattaatgtgagttacctcac
Delta-ENO1_Terminator-R tgagatatatgtgggtaattagataattgttgggattccattgttgataaaggctataatattaggtatacagaatatactagaagttctcctcgaggatagatctcctatgcggtgtgaaataccgc