Skip to main content

Table 3 Strains, plasmids and primers used in this study

From: Engineered Thermoanaerobacterium aotearoense with nfnAB knockout for improved hydrogen production from lignocellulose hydrolysates

  Description Reference or source
Strain
 T. aotearoense SCUT27 Wild-type Our lab
 T. aotearoense SCUT27/∆nfnAB nfnAB deletion mutant of SCUT27 This study
 E. coli DH5α Used for plasmid screening and propagation TianGen
Plasmid
 pBluescript II SK+ Standard cloning vector Stratagene
 pPuKAd As the template for kanamycin resistance gene amplification [44]
 pBlunAB Disrupts nfnAB with kanamycin resistance gene This study
Primer Sequence (5′–3′)  
nfnA-F GGTACCCCTTGCAGGCATTTCTTCC  
nfnA-R GAATTCGAAGGTTGCCCTGTTCACG  
nfnB-F GGATCCCCAACTGTGACTCTGCATC  
nfnB-R GAGCTCAGAAGAAGCAATTGAATCC  
aph-F GGATCCGATAAACCCAGCGAACC  
aph-R GAATTCATCGATACAAATTCCTCGTAGG  
M13-F CGCCAGGGTTTTCCCAGTCACGAC  
M13-R AGCGGATAACAATTTCACACAGGA  
probe-F TTTGCTCGGAAGAGTATGAA  
probe-R GCCACTTACTTTGCCATCT