Skip to main content

Table 2 Primers used in this study

From: Acceleration of cellodextrin phosphorolysis for bioelectricity generation from cellulosic biomass by integrating a synthetic two-enzyme complex into an in vitro synthetic enzymatic biosystem

Primer Sequence (5′–3′) Template
VF-CDP-CtDoc acatatagtgactcttaagtttaaagttgattggaacaaggcaactgctt pET20b-tim-ctdoc
VR-CDP-CtDoc aagagcgacaatgaaatcattagtatacatatagaggaagaatttcaatt
IF-CDP-CtDoc ttaactttaagaaggagatatacatatgattactaaagtaacagcgagaa pET21c-ctcdp
IR-CDP-CtDoc ttcgtcaacggaacaaggttagttgaaatttgaattctcagtgatataca
VF-CDP-RfDoc acatatagtgactcttaagtttaaacccggcacaaagctcgttcctacat pET20b-fbp-rfdoc
VR-CDP-RfDoc The same with VR-CDP-CtDoc
IF-CDP-RfDoc The same with IF-CDP-CtDoc pET21c-ctcdp
IR-CDP-RfDoc tacatccttgctcgaaacacggcccaaatttgaattctcagtgatataca
VF-PGM-CcsDoc actgctggaagaagcactgaaaggtggtaaggtattaccaggaatccaag pET20b-ald-ccsdoc
VR-PGM-CcsDoc gcttccatggtttgtcaaacgggtatacatatagaggaagaatttcaatt
IF-PGM-CcsDoc ttaactttaagaaggagatatacatatgggcaaactgtttggtaccttcg pET20b-tkpgm
IR-PGM-CcsDoc gaacctaaggaccattatggaatggtggaaagtcacgaagaaggtcgtca
VF-PGM-RfDoc actgctggaagaagcactgaaaggtcccggcacaaagctcgttcctacat pET20b-fbp-rfdoc
VR-PGM-RfDoc The same with VR-PGM-CcsDoc
IF-PGM-RfDoc The same with IF-PGM-CcsDoc pET20b-tkpgm
IR-PGM-RfDoc tacatccttgctcgaaacacggccctggaaagtcacgaagaaggtcgtca