Skip to main content

Table 4 Primers designed for cloning and overexpression of the fhlA gene

From: Enhanced biohydrogen production from cotton stalk hydrolysate of Enterobacter cloacae WL1318 by overexpression of the formate hydrogen lyase activator gene

Primers Sequence Source
fhlA-fw ATGAGCGATCTTGGACAGCAG This study
fhlA-rv TTAATTCAGGCTCTCTTTATCA This study
PfhlA-fw ATGAATTCGAGCGATCTTGGACAGCAG This study
PfhlA-rv CGGCTCGAGTTAATTCAGGCTCTCTTTATCA This study