Skip to main content

Table 5 Primers used in this study

From: Recombinant bacteriophage LysKB317 endolysin mitigates Lactobacillus infection of corn mash fermentations

Primer name Sequence (5′–3′) Purpose Reference
Sau_F CATCATCACCACCATCACGCACTTTACGTAGTTGACGTT Amplification of LysKB317 for cloning This study
Sau_R GTGGCGGCCGCTCTATTATTTAAAGGTTCCGAATGCTTC
pRham_F GCTTTTTAGACTGGTCGTAGGGAG Verify gene insert Lucigen Co
pETite_R CTCAAGACCCGTTTAGAGGC