Skip to main content

Table 2 List of primers used in this study

From: Development of genetic tools for the thermophilic filamentous fungus Thermoascus aurantiacus

PCR Name Sequence
hph1
 FWD RG1 CTCGGAGGGCGAAGAATCTC
 REV RG2 ATTTGTGTACGCCCGACAGT
hph2
 FWD TS222 CGTAGTACCTGAGCACCCCTCTGAGCTCTT
 REV TS223 CCATTTGTCTCAACTCCGGAGCTGACATCGA
pyrE
 FWD RG75 GACGGTTTCTATACAGTCTTTTCAG
 REV RG76 CCCCCGATGTTACTCCGC
pyrG
 FWD LLK683 TTCTTACTACAACTTGGCAACCTTC
 REV LLK686 ACAAGCCAAATTACCAGCAGAATAC