Skip to main content

Table 3 List of protospacers and PAM sequences used in this study

From: Development of genetic tools for the thermophilic filamentous fungus Thermoascus aurantiacus

Target locus ID Protospacer sequence (5′–3′) PAM (5′–3′)
pyrG gRNA 1 CTTTTGCGCGCGAGCGCCGT AGG
pyrG gRNA 2 GAGTCTTCCTGCACAGGCCT GGG
pyrG gRNA 3 TCGGCGCCCGACTTCCCCTA CGG