Skip to main content

Table 1 Strains, gene cassettes, and primers used in this study

From: Metabolic engineering of Yarrowia lipolytica for thermoresistance and enhanced erythritol productivity

Strains/plasmids/primers Genotype/sequences (5′ → 3′) References/restriction sites
E. coli strain
 BL21(DE3) B F ompT gal dcm lon hsdSB(rBmB) λ(DE3 [lacI lacUV5-T7p07 ind1 sam7 nin5]) [malB+]K-12S) pLysS New England BioLabs
 TOP10 F– mcrAΔ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara leu) 7697 galgalrpsendA1 nupG Thermo Fisher Scientific
 BL21/AraDH1 BL21(DE3) pET28a-AraDH1 This work
 BL21/AraDH2 BL21(DE3) pET28a-AraDH2 This work
 BL21/MDH1 BL21(DE3) pET28a-MDH1 This work
 BL21/MDH2 BL21(DE3) pET28a-MDH2 This work
 BL21/XDH1 BL21(DE3) pET28a-XDH1 This work
Y. lipolytica strains
 HCY107 (CGMCC7326, or ery929) Suc-, Lac-, Mal- Cheng et al., 2018
 HCY109 CGMCC7326 derivative, ery919ku70 This work
 HCY109-2 HCY109 derivative, ku70ura3 This work
 HCY110 HCY109 derivative, ku70AraDH1 This work
 HCY111 HCY109 derivative, ku70AraDH2 This work
 HCY112 HCY109 derivative, ku70mdh1 This work
 HCY113 HCY109 derivative, ku70ura3mdh2 This work
 HCY114 HCY109 derivative, ku70xdh1 This work
 HCY115 HCY113 derivative, ku70ura3mdh2eyd1 This work
 HCY117 HCY116 derivative, ku70mdh2eyd1::Sc.rsp5 This work
 HCY118 HCY117derivative, ku70mdh2eyd1::Sc.rsp5::zwf1::gnd1 This work
Plasmids
 pUC19 LacZ, AmpR  
 pET28a LacI, T7 promoter, KanR Novagen
 pET28a-ylAraDH1 Containing ylAraDH1 gene g1595.t1 (YALI0F02211g) This work
 pET28a-ylAraDH2 Containing ylAraDH2 gene g3858.t1 (YALI0E05643g) This work
 pET28a-ylMDH1 Containing ylMDH1 gene g5130.t1 (YALI0B16192g) This work
 pET28a-ylMDH2 Containing ylMDH2 gene g2069.t1 (YALI0D18964g) This work
 pET28a-ylXDH1 Containing ylXDH1 gene g4121.t1 (YALI0E12463g) This work
The above plasmids (except pUC19 and pET28a) were used to transform BL21(DE3) and in the production of ylAraDH1, ylAraDH2, ylMDH1, ylMDH2 and ylXDH1 recombinant enzymes
 pHB4-621XDH pHB4-Cre derivative, hp4d-621XDH-TT-hp4d-Cre This work
 pWSV-Ku70-loxP-hph-loxP up Ku70-loxP-pLeu2-hph-TT-loxP-dw Ku70 This work
 pWSV-AraDH1-loxP-hph-loxP up AraDH1-loxP-pLeu2-hph-TT-loxP-dw AraDH1 This work
 pWSV-AraDH2-loxP-hph-loxP up AraDH2-loxP-pLeu2-hph-TT-loxP-dw AraDH2 This work
 pWSV-MDH1-loxP-hph-loxP up MDH1-loxP-pLeu2-hph-TT-loxP-dw MDH1 This work
 pWSV-MDH2-loxP-hph-loxP up MDH2-loxP-pLeu2-hph-TT-loxP-dw MDH2 This work
 pWSV-XDH1-loxP-hph-loxP up XDH1-loxP-pLeu2-hph-TT-loxP-dwXDH1 This work
 pWSV-EYD1-loxP-hph-loxP up EYD1-loxP-pLeu2-hph-TT-loxP-dw EYD1 This work
 pINA1313-RSP5 up zeta-ura3-hp4d-RSP5-TT–dw zeta This work
The above plasmids are used to delete ylAraDH1, ylAraDH2, ylMDH1, ylMDH2, ylXDH1, PGI genes and overexpress Sc.rsp5 gene for erythritol synthesis
Primers Sequences (5′ → 3′) Restriction sites
Primers used for amplification of ylAraDH1, ylAraDH2, ylMDH1, ylMDH2 and ylXDH1 genes and cloned to pET28a by Gibson assembly
P28a-ylAraDH1-F CTGGTGCCGCGCGGCAGCCATATGTCTCTCTTTTCACTCGCCAAGAAAAC NdeI
P28a-ylAraDH1-R GTGGTGGTGGTGGTGGTGCTCGAGTTACCAGATGGTGTAACCTCCATCGAC XhoI
P28a-ylAraDH2-F CTGGTGCCGCGCGGCAGCCATATGTCCAACTCCGCCAAAGCCGCTGTC NdeI
P28a-ylAraDH2-R GTGGTGGTGGTGGTGGTGCTCGAGTTAAATAATAGTGTAACCACCATCAATG XhoI
P28a-ylMDH1-F CTGGTGCCGCGCGGCAGCCATATGCCTGCACCAGCAACCTACGCTAC NdeI
P28a-ylMDH1-R GTGGTGGTGGTGGTGGTGCTCGAGCTAAGGACAACAGTAGCCGCCATCAAC XhoI
P28a-ylMDH2-F CTGGTGCCGCGCGGCAGCCATATGATGTCTGGACCTTCCACCCTCGCCAC NdeI
P28a-ylMDH2-R GTGGTGGTGGTGGTGGTGCTCGAGCTAAGGAGCGCAGTAGCCACCATCGAC XhoI
P28a-ylXDH1-F CTGGTGCCGCGCGGCAGCCATATGTCTTCTAACCCGTCATTTGTTCTTC NdeI
P28a-ylXDH1-R GTGGTGGTGGTGGTGGTGCTCGAGCTACTCCTCCTCGGGACCGTCAATGATG XhoI
The below primers are used for verification of Ku70, ylAraDH1, ylAraDH2, ylMDH1, ylMDH2, ylXDH1, ylEYD1, pgi genes knockout in Y. lipolytica
PKu70- knockout -F ATGGAATGGATTTCACATCTGGAGAACG  
PKu70- knockout -R TCACTTCCCATAGTACTTTTTGACCAC  
PAraDH1- knockout -F ATGTCTCTCTTTTCACTCGCCAAGAAAAC  
PAraDH1- knockout -R CTCTTGTGGTGCTCTCGAATGGCCTTGA  
PAraDH2- knockout -F ATGTCCAACTCCGCCAAAGCCGCTGTC  
PAraDH2- knockout -R TTAAATAATAGTGTAACCACCATCAATG  
PMDH1- knockout -F ATGCCTGCACCAGCAACCTACGCTAC  
PMDH1- knockout -R CACTGTATTACATCGAGCGAATCCA  
PMDH2- knockout -F ATGTCTGGACCTTCCACCCTCGCCAC  
PMDH2- knockout -R CTAAGGAGCGCAGTAGCCACCATCGAC  
PXDH1- knockout -F ATG TCTTCTAACCCGTCATTTGTTCTTC  
PXDH1- knockout -R CTACTCCTCCTCGGGACCGTCAATGATG  
PEYD1- knockout -F CGAGACTCCCTCTGAGGAGTTCCTG  
PEYD1- knockout -R TTACCAGACGTGGTGGCCACCGCAGAC  
The below primers are used to construct URA3 gene disruption cassette and verify the corrected URA3 gene mutant
PURA3-upstream-F CTGAAACGTTATCTTATATGAACTCC  
PURA3-upstream-R TTTGGTGGTGAAGAGGAGACTGAAATAAATTTAG  
PURA3-downstream-F CTAAATTTATTTCAGTCTCCTCTTCACCACCAAATATGTAATTTAACTGTGTATATAG  
PURA3-downstream-R CAGGCCAGTCCCGCCTCTCCTTTC  
PURA3-verify-F GTGTGCATGATCAAGACCCATATC  
PURA3-verify-R AGGTCGGTTCTGGGCAATGAAGCC  
Primers used to detect the mRNA levels of ylAraDH1, ylAraDH2, ylMDH1, ylMDH2, ylXDH1 knockout mutants and mRNA levels of Sc.rsp5, ylTKL1 at 30–35 °C
PAraDH1-qPCR-F GGTATCGCAGCTGCCAAGCAGCTTC  
PAraDH1-qPCR-R GATTCTGTTTCTGTTTCAGAAAC  
PAraDH2-qPCR-F CGAGCCAACGCCGGATCCAAGGAAG  
PAraDH2-qPCR -R CTCAATGGCATCCAGACCCAGGTC  
PMDH1-qPCR -F GTATCCAAGAACATCATGGAGCG  
PMDH1-qPCR-R CATTTGTAAGCCTTAGATCGGACTCC  
PMDH2-qPCR -F TTCCCCACCAACATCATGGACCG  
PMDH2-qPCR-R CTTGTAGGCCTTGGCCTTGACGCC  
PXDH1-qPCR-F TGCGGCTCGGATGTCCACTACTATC  
PXDH1-qPCR-R GTTGTATCGTCCCTCCTTGTACTC  
Prsp5-qPCR-F TCCGCAGCGAAGAAAACGTTAAATC  
Prsp5-qPCR -R GTCTACCACTCGATGTAGCAGTATC  
Ptkl-qPCR-F AAGACTCCCGGCCACCCCGAGGCTG  
Ptkl-qPCR-R CTCCGAAGATGCAGTAAGTGTAGTT  
Pβ-actin-up ACTCTGGTGATGGTGTCACCCACG  
Pβ-actin-down TCGGACGATTTCTCGCTCGGCGGAG