Skip to main content

Table 3 Primers employed for DNA amplification in this study

From: Modulating redox metabolism to improve isobutanol production in Shimwellia blattae

Name Sequence (5´–3´)
ADH-F CCCCCCGGGTGACTAAGGAGGTGAATAATGAAAGCAGCAGTAGTAAGACAC (XmaI)
ADH-R GCTCTAGATTATTTAGTAAAATCAATGACCATTCGGC (XbaI)
PntAB-F CGCTGCAGTCATCAATAAAACCGATGGAAGGG (PstI)
PntAB-R CGAGCTCAGCAGAGGCCGTCAGGG (SacI)