Skip to main content

Table 4 PCR primers and templates used to prepare plasmid constructs

From: Feasibility study of on-site solid-state enzyme production by Aspergillus oryzae

Primer pairSequence (5′ to 3′)Template
PyrG disruption cassette
 pyrG-uptcgagctcggtacccccagaggtgactttatccaagattccAOK27L
cccgggcaattgccgcgaaaaattaaattgaatc
 pyrG-downcggcaattgcccggggtagtggtggatacgtactccttttatgAOK27L
ctctagaggatccccttcaggtcacgttctaagcttatcagc
LigD deletion cassette
 ligD-uptcgagctcggtacccggttactgctctcccttgatgatgAOK27L
taggtagtgaacctatttcgagagcag
 ligD-downtaggttcactacctagcggccgcacaggcaccttgcatcatcatcAOK27L
ctctagaggatccccggaccgacgattcgttgaagag
 ligD-up2acaggtatcgaattcgtccttgtgacgacgagctcgAOK27L
ggtgcctgtgcggccgctaggtagtgaacctatttcgagagcag
 An_pyrG setgaattcgatacctgtcgaaagaaatggaagFGSC-A4
cactacctagcggcctcagtgcttgtctaccagattagggag
Enzyme production cassettes
 pyrG-up2actagtcatatggatccagaggtgactttatccaagattccAOK27L
gtagacaagcactgacaattgccgcgaaaaattaaattgaatctatgg
 An_pyrG-T setacccggggatccgatgaattcgatacctgtcgaaagaaatggaagFGSC-A4
Tcagtgcttgtctaccagattaggg
 pyrG-down-TgacagtcgtcgttgggtagtggtggatacgtactccttttatggAOK27L
tcgagctcggtacccttcaggtcacgttctaagcttatcagc
 P-enoA142ccaacgacgactgtctcattactagtcOZ
attcatcggatcccgggtttgcgagtggtttggtaaaaggtag
 T-agdAgaagcgtaacaggatagcctagaccAOK27L
aattcatcggatcccagtaacccattcccggttctctag
 cbhaccactcgcaaacccatgtctgccttgaactctttcaatatgtacaagH1
atcctgttacgcttcctacaaacattgagagtagtaagggttcacg
 bglaccactcgcaaacccatgtactccgcctttctgctcH1
atcctgttacgcttctcactggaggcactgggag
 exaccactcgcaaacccatggtccgccctaccatccSG
atcctgttacgcttctcactgctggagatcctggac
  1. Templates are genomic DNAs purified from the indicated strains. AOK27L: A. oryzae strain AOK27L, FGSC-A4: Aspergillus nidulans strain FGSC-A4, OZ: A. oryzae strain OZ, H1: T. cellulolyticus strain H1, SG: T. aurantiacus strain SG