Skip to main content

Table 5 PCR templates and primers used to prepare transformation inserts

From: Feasibility study of on-site solid-state enzyme production by Aspergillus oryzae

Primer pairSequence (5′ to 3′)Template
PyrG or ligD deletion cassettes
 pRIgcaattaatgtgagttagctcactcpRIdP or pRIdLR
ggatatcggggaagaacagtatgtc
Enzyme production cassettes
 pMD20ccagtgagcgcaacgcaattaatgtgagttagpPPO enzyme
gggatgtgctgcaaggcgattaagttg
  1. Templates are the plasmid constructs prepared in this study (Fig. 6)