Skip to main content

Table 7 Primers used in this study

From: Production of the biocommodities butanol and acetone from methanol with fluorescent FAST-tagged proteins using metabolically engineered strains of Eubacterium limosum

Primer Sequence 5′–3′ Length (bp)
FW_C1_adhE2 ttaaatgtattgggagggtggatccatgaaagttacaaatcaaaaagaac 50
RV_N2_adhE2 agcttgcatgtctgcaggcctcgagttaaaatgattttatatagatatccttaagttc 58
FW_act_NdeI gaccgcggccgctgtatccatatgtcaagaagaggcac 38
RV_act_XhoI agcttgcatgtctgcaggcctcgagttacttaagataatcatatataacttcag 54
FW_Pthlsup_FAST_NdeI atgaccgcggccgctgtatccatatgtttttaacaaaaagtattgaaatttg 52
RV_Pthlsup_FAST_XhoI aagcttgcatgtctgcaggcctcgagtcataccctcttaac 41
FW_PbgaL_NdeI gaccgcggccgctgtatccatatgtaatttagatattaattctaaattaagtgaaattaatatag 65
RV_PbgaL_BamHI caaatgctacgtgttccatggatccaccctcccaatacatttaaaataattatg 54
FW_Pthl_NdeI gaccgcggccgctgtatccatatgtcaagaagaggcacctcatc 44
RV_Pthl_BamHI caaatgctacgtgttccatggatcctaacctcctaaattttgatacgg 48
FW_tdFAST2-opt_BamHI ttaaatgtattgggagggtggatccatggagcatgtagcttttg 44
RV_tdFAST2-opt_XhoI agcttgcatgtctgcaggcctcgagtcaaacccgtttgacgaag 44
RV_C1_adhE2-FAST ctacgtgttcagaaccaccaccaccaaatgattttatatagatatccttaagttc 55
FW_C2_adhE2-FAST aaaatcatttggtggtggtggttctgaacacgtagcatttggaag 45
RV_C2_FAST agcttgcatgtctgcaggcctcgagtcataccctcttaacgaaaac 46
FW_N1_FAST ttaaatgtattgggagggtggatccatggaacacgtagcatttg 44
RV_N1_FAST-adhE2 ttgtaactttagaaccaccaccacctaccctcttaacgaaaac 43
FW_N2_FAST-adhE2 taagagggtaggtggtggtggttctaaagttacaaatcaaaaagaactaaaac 53
FW_C1_adc acccatggctgtttaggtaccttttatgttaaaggatgaagtaattaaac 50
RV_C1_adc-FAST ctacgtgttcagaaccaccaccacccttaagataatcatatataacttcagc 52
FW_C2_adc-FAST ttatcttaagggtggtggtggttctgaacacgtagcatttggaag 45
FW_N1_FAST-adc acccatggctgtttaggtaccttttatggaacacgtagcatttg 44
RV_N1_FAST-adc catcctttaaagaaccaccaccacctaccctcttaacgaaaac 43
FW_N2_FAST-adc taagagggtaggtggtggtggttctttaaaggatgaagtaattaaacaaattag 54
RV_N2_adc agcttgcatgtctgcaggcctcgagttacttaagataatcatatataacttcag 54