Skip to main content

Table 4 Primers used in the study

From: Rational engineering of Saccharomyces cerevisiae towards improved tolerance to multiple inhibitors in lignocellulose fermentations

Gene Primer Primer 5–3′ sequence References
ADH6 ADH6-F GCGCCTTAATTAAATGTCTTATCCTGAGAA This study
ADH6 ADH6-R GTTAGGCGCGCCCTAGTCTGAAAATTC This study
PAD1 PAD1-F GGCCTTAATTAAATGCTCCTATTTCCAAGAAG This study
PAD1 PAD1-R GATTGGCGCGCCTTACTTGCTTTTTATT This study
ICT1 ICT1-F GGCCTTAATTAAATGTGGACAAACACTTTCAAATGG This study
ICT1 ICT1-R GATTGGCGCGCCTTACTTTGACAGGAAC This study
ARI1 ARI1-F GGCCTTAATTAAATGACTACTGATACCACTG This study
ARI1 ARI1-R GATTGGCGCGCCTTAGGCTTCATTT This study
FDH1 FDH1-F GGCCTTAATTAAATGTCGAAGGGAAAGG This study
FDH1 FDH1-R GATCGGCGCGCCTTATTTCTTCTGT This study
TAL1 TAL1-F GCGCTTAATTAAATGTCTGAACCAGCTC This study
TAL1 TAL1-R GATAGGCGCGCCTTAAGCGGTAACTTTC This study
FPS1 FPS1-L CCGAAGCTTATGAGTAATCCTCAAAAAGC [41]
FPS1 FPS1-R CCAGAGCTCTCATGTTACCTTCTTAGCATT [41]
CUP1 CUP1-L CTTGGTACCTGGGCGCTATACGTGCATATG [41]
PGK1 PGKseq-L CTAATTCGTAGTTTTTCAAGTTCTTAGATGC [54]
ENO2 BKDENOpt-L TCAGTCTAGAGCGGCCGCCTTCTAGGCGGGTTATC This study
  1. Restriction sites underlined