Skip to main content

Table 1 Primer sequences for these CCM-related genes used in present real-time PCR analysis

From: Proteomic and biochemical responses to different concentrations of CO2 suggest the existence of multiple carbon metabolism strategies in Phaeodactylum tricornutum

Primers Gene ID Sequence (5′-3′) Annealing temperature (°C) Amplicon size (bp)
rps 7197743 Sense: CGAAGTCAACCAGGAAACCAA
Antisense: GTGCAAGAGACCGGACATACC
60 166
tbp 7204339 Sense: ACCGGAGTCAAGAGCACACAC
Antisense: CGGAATGCGCGTATACCAGT
60 175
ica 7196274 Sense: GGGAACTGAGGCTGGAAC
Antisense: CGAGCATGGAGACGGTAG
60 240
pepck 7195549 Sense: AGCGGAACTGGAAAGACC
Antisense: CATCGTCCCGAATAGCC
60 208
ppdk 7203153 Sense: CGCCAAGGCAACAGGTAA
Antisense: GGTGCTCAGCCGTCAAAT
60 170
pepc 1 7201832 Sense: TGACAAGAGTGCCTCGGGTATT
Antisense: CAGCCACTTCGTTTCCTGTTTC
60 134
pepc 2 7203602 Sense: AACCCATCCGTCTATCGT
Antisense: GGTACTCGGCACAACTCAC
60 241
NADP-me 7201046 Sense: CATTGGGCTTGGCGTATT
Antisense: TGCTACTCCCGTTTCGTG
60 202
NAD-me1 7197107 Sense: ATTGCTGGTGCGGGTAGT
Antisense: TTGTAACGCCGAGAAGGA
60 250
mdh 7199385 Sense: CGCTTCCGTGGCTTCTTA
Antisense: CCTGGTCGGGATGTGACTG
60 208
pyc1 7198165 Sense: TTGGCTTTGTCCGTCAG
Antisense: TGTTCCAGCAGTATCGTGT
60 164
pyc2 7195500 Sense: CGTCCGACTCACATCACAA
Antisense: GAACCAAACCAACTTCCTCC
60 206