Skip to main content

Table 3 Oligonucleotides used in this study

From: Enhanced production of ectoine from methane using metabolically engineered Methylomicrobium alcaliphilum 20Z

Oligonucleotides Sequence
repBDown F TGACATGATTACGCCAAGCTTATGAAGGAATCGTTGTCGTACCC
repBDown R ATATCGCCGCATTGGCAGGTTACGACCCTAAGC
repBUp F ACCTGCCAATGCGGCGATATGGGGAAAAT
repBUp R AAAACGACGGCCAGTGAATTCTTATGAAATGATCCGCCGTTTGTGC
repBDI F TGTGTGGAATTGTGAGCGGA
repBDI R GGTCGAGTGGCTTAAAACGC
repBUI F GCCTTTCAACGGCCATCTTC
repBUI R TTTCTGCGGACTGGCTTTCT
repB confirm F TCCTTGGCCACCGAATTACC
repB confirm R GCACTTTGCAACCCGACAAT
korB confirm F ACCGTCTTGAGTTGGTCGTC
korB confirm R AACTAAGAGCTTCGGCCCAC
trbF confirm F CTAACCCGTACCTGACTGCC
trbF confirm R ACGCACATAGATACCGAGCG
ectDDown F TGACATGATTACGCCAAGCTTTGTTCAGCAACAAAAGACAGAA
ectDDown R ATCACGTAACATGCTTAGAATGTTAATAATGTTGA
ectDUp F TTCTAAGCATGTTACGTGATTGATAAAAATCTTCA
ectDUp R AAAACGACGGCCAGTGAAAGTGAATTCTTGTACTGATGTTTCTTACCCCT
ectDDI F CACTCATTAGGCACCCCAGG
ectDDI R CAATGGAAAACCCGGCAGTG
ectDUI F CACTGCCGGGTTTTCCATTG
ectDUI R ACGACGGCCAGTGAATTCTT
ectD confirm F TGCTTCATCGTTGACGCTCT
ectD confirm R ATGGCAAGTCAGTCGAGCAA
ectR Down F TGACATGATTACGCCAAGCTTTCTAATTCTCTCCTGAGCAAGATG
ectR Down R TTATTAGAGCCATTGATCACCAATCATTAGAATAG
ectRUp F GTGATCAATGGCTCTAATAATTCAGCTCAGCT
ectRUp R AAAACGACGGCCAGTGAATTCAGAACATCAAGAGGTCTGGATTGT
ectRDI F TTTGCTGGCCTTTTGCTCAC
ectRDI R GTAAATCGGTGGCGCGAATC
ectRUI F TACGTAGAGTGATTCGCGCC
ectRUI R CGGACTGGCTTTCTACGTGT
ectR confirm F GGGCATTTGCTAATCAGCCG
ectR confirm R AACAGCACCGCTTCCAAGTA