Skip to main content
Download PDF

Enhancement of β-carotene content in Chlamydomonas reinhardtii by expressing bacterium-driven lycopene β-cyclase

Biotechnology for Biofuels and Bioproducts volume 16, Article number: 127 (2023) Cite this article

Abstract

β-Carotene is one of the economically important carotenoids, having functions as the antioxidant to remove harmful free radicals and as the precursor for vitamin A and other high-valued xanthophyll such as zeaxanthin and astaxanthin. Lycopene cyclase plays an important role in the branching of β-carotene and α-carotene. Aiming to develop the microalgae with enhanced β-carotene productivity, the CrtY gene from bacterium Pantoea agglomerans was integrated into Chlamydomonas reinhardtii. The lycopene-producing E. coli harboring CrtY gene produced 1.59 times of β-carotene than that harboring DsLcyb1 from Dunaliella salina (a microalga with abundant β-carotene), confirming the superior activity of CrtY on β-carotene biosynthesis. According to the pigment analysis by HPLC, in microalgal transformants that were confirmed by molecular analysis, the expression of CrtY significantly increased β-carotene content from 12.48 mg/g to 30.65 mg/g (dry weight), which is about 2.45-fold changes. It is noted that three out of five transformants have statistically significant higher amount of lutein, even though the increment was 20% in maximum. Besides, no growth defect was observed in the transformants. This is the first report of functional expression of prokaryotic gene in eukaryotic microalgae, which will widen the gene pool targeting carotenoids biosynthesis using microalgae as the factory and thereby provide more opportunity for high-valued products engineering in microalgae.

Introduction

Carotenoids are a group of important natural pigments commonly synthesized by plants, fungi, bacteria, and algae, presenting yellow, orange, red, and even purple colors [1]. Structurally, most carotenoids are terpenoid molecules with C40 backbone driven from the connection of eight isoprene units end-to-end and varied end groups [1,2,3]. According to the modification of end groups, carotenoids can be divided into two major groups, including carotenes (such as α-carotene, β-carotene, γ-carotene, and lycopene) and xanthophylls (such as β-cryptoxanthin, zeaxanthin, astaxanthin, and lutein) [2, 3]. Currently, there are more than 850 carotenoids were found naturally, including about 50 carotenes and about 800 xanthophylls (up until 2018) [3]. As the major precursor for vitamin A synthesis in the body, people and animals should uptake carotenoids from food to maintain healthy [3]. In photosynthetic organisms, carotenoids play important role in light harvesting for normal photosynthesis [3,4,5]. Besides, as a chain breaking anti-oxidants, carotenoids could protect cells and organisms against the photo-oxidation releasing harmful free radicals [4,5,6]. It has been reviewed that carotenoids can be used as medicine for their effective in immune regulation, anti-cancer, and anti-aging [7]. Therefore, carotenoids have a great economic value as nutrients, additives, or medicine in food, feed, aquaculture, pharmaceutical, and cosmetic industries.

Lots of effects have been placed to achieve carotenoids with high quality and low cost, especially by metabolic engineering approaches, on the basis of well-studied carotenoids biosynthesis pathway [8,9,10,11]. It has been noted that astaxanthin, β-carotene, and lutein approximately account 60% of the carotenoids market [12]. In the other hand, β-carotene is an important node in the carotenoid metabolism, because it is the precursor of lots of xanthophylls such as β-cryptoxanthin, zeaxanthin and astaxanthin, as well as it is also the competitor of other xanthophylls such as lutein [7, 8]. Therefore, microbial cell factories such as Escherichia coli, yeast, and microalgae were engineered to improve its productivity, through the integration of key enzymes or the whole gene cluster associated with carotenoids biosynthesis [13,14,15,16,17,18]. According to the documentation, the type of lycopene cyclization leads to the branch division of α-carotene and β-carotene [8] (Fig. 1). Previously, four major groups of lycopene cyclase have been identified, including (1) the CrtY-type β-cyclase from many carotenogenic proteobacteria, Streptomyces spp., and the Chloroflexi; (2) CrtL-type cyclase in some cyanobacteria and plants; (3) the heterodimeric cyclase from some Gram-positive bacteria; and (4) CruA/CruP-type cyclase in green sulfur bacteria and cyanobacterial genomes that lack the CrtL-type lycopene cyclase [19,20,21]. The CrtYB from red yeast Xanthophyllomyces dendrorhous, belonging to the heterodimeric cyclase group and displaying biofunction of phytoene synthase and lycopene cyclization, has been expressed in microalgae Chlamydomonas reinhardtii and increased the β-carotene content by 72% [16]. Besides, the overexpression of native LCYE gene in C. reinhardtii significantly increased total lutein production at the maximum of 2.6-fold than the wild type and did not significantly increase the β-carotene content [22]. However, even though CrtY-type β-cyclase has been widely used for the β-carotene production in E. coli, Saccharomyces cerevisiae, Y. lipolytica, and Rhodobacter sphaeroides, its performance on microalgae targeting on the increased β-carotene productivity has not been studied [23].

Fig. 1
figure 1

The simple schematic representation of the β-carotene biosynthesis and its competition branch. LCYB adds the β-ring at the end of lycopene while LCYE adds the ε-ring at the end of lycopene

Full size image

In this study, the CrtY from bacterium Pantoea agglomerans belong to CrtY-type β-cyclase was tested in E. coli to confirm its superior performance on β-carotene production, compared with alga-driven lycopene β-cyclase. Subsequently, CrtY was integrated into the genome of C. reinhardtii and functionally expressed. This is an example of successful expression of prokaryotic gene in eukaryotic microalgae, which will widen the gene pool targeting carotenoids biosynthesis and thereby provide more opportunity for high-valued products engineering in microalgae.

Materials and methods

Strains, culture conditions, and sampling

A cell wall-deficient microalgae strain, Chlamydomonas reinhardtii cc849, used in this study was obtained from Guangdong Technology Research Center for Marine Algal Bioengineering. The algal cells of cc849 were cultured in Tris–acetate–phosphate (TAP) medium under a photoperiod of 16/8 h light and dark cycle with the photon fluence rate of 50 µmol m−2 s−1 at 22 °C in a growth chamber. Transformed algal cells were maintained in the TAP plate containing 8 μg/mL zeocin and 100 μg/mL ampicillin and proliferated in the TAP liquid medium without antibiotics. For the high light treatment, algal cells at the late of logarithmic phase were exposed to a photon fluence rate of 900 µmol m−2 s−1 for 6 h.

The E. coli strain DH5α was used to proliferate the constructed plasmid and the E. coli strain BL21(DE)3 was used to produce carotenoids in this study. The lycopene-producing BL21(DE)3 was maintained previously in our lab, containing the plasmid pAC-Lyco, which containing the gene cluster producing lycopene including CrtE, CrtI, CrtB, idi and CrtY genes adapted from pFZ153 [24] (Additional file 1: Fig. S1A) with chloramphenicol selection marker. Both DH5α and BL21(DE)3 cells were cultured in LB media with or without proper antibiotics (100 μg/mL ampicillin and/or 34 ug/mL chloramphenicol) at 37 °C in an incubator with or without shaking at 220 rpm. For the production of carotenoids, IPTG was added into the culture. Algal cells and E. coli cells were harvested by centrifugation at 4000 rpm for 8 min at 4 °C and then frozen by liquid nitrogen for further processing.

Plasmid construction

To construct the plasmid expressing lycopene β-cyclase in E. coli, the vector pET-Duet-1 was used as the backbone. Lycopene β-cyclase genes used for plasmid construction included CrtY from Pantoea agglomerans (GenBank accession number: WP_062759152) and DsLcyb1 from Dunaliella salina (GenBank accession number: ACA34344). After codon-optimization based on E. coli, DsLcyb1 was synthesized and cloned into pET-Duet-1 at BamHI/EcoRI site, to construct pET-DsLcyb1. The CrtY was amplified from pFZ153 [24] with primers CrtYF20 (5′-GCCAggatccATGCCGCGGTATGATCTGATTC-3′) and CrtYR20 (5′- GCTCgaattcATAGTAATCCTCCTTCATTGCATC-3′) containing BamHI and EcoRI, respectively. PCR was performed using SuperFi DNA polymerase (Invitrogen Life technologies, Carlsbad, CA, USA) as recommended. The PCR products of CrtY were digested with BamHI/EcoRI and then subcloned into pET-Duet-1 to form pET-CrtY. The restriction enzyme digestion (Thermo Scientific FastDigest) and vector construction using T4 DNA ligase (Invitrogen) were performed as the manual.

To construct the plasmid expressing lycopene β-cyclase in microalga C. reinhardtii, the vector pDb124 was used, which contains the psaD promoter and psaD terminator to drive the expression of target gene (Additional file 1: Fig. S1B). pDb124 also contains the bleomycin reporter cluster that can be used to screen transformants. CrtY was codon-optimized for better expression according to the nucleotide preferences of C. reinhardtii nuclear genome. Additionally, a chloroplast signal peptide (CTP) was fused to the N-terminal of CrtY. The codon-optimized CTP-CrtY was synthesized and cloned into the pDb124 at the NheI site to form pDb-CrtY. The synthesis and subclone of target nucleotides were performed by GenScript Biotech Corp. (Nanjing, China). The accuracy of nucleotides in each plasmid was confirmed by sequencing.

E. coli and algal transformation

To produce target carotenoids in E. coli, plasmids pET-DsLcyb1 and pET-CrtY were transferred into the chemical competent cell of lycopene-producing E. coli using heat-shock method [25]. To produce target carotenoids in C. reinhardtii, the plasmid pDb-CrtY was transferred into algal cells using glass-bead method with few modifications [26]. The algal transformation process was performed as described, with additional information that NotI was used to linearize plasmids.

DNA/RNA extraction and PCR/qPCR analysis

The proliferated plasmid DNA was extracted from E. coli strain DH5α using Omega Plasmid Mini Kit II (Omega Bio-Tek, USA). Genomic DNA was extracted from algal cells using M5 HiPer Plant Genomic DNA Kit (Mei5 Biotechnology, Beijing, China) and total RNA was extracted using SteadyPure Plant RNA Extraction Kit (Accurate Biotech. Co., Ltd, Hunan, China). The first strand of cDNA was synthesized by PrimeScriptTM RT reagent Kit with gDNA Eraser (Takara, Dalian, China). The DNA/RNA extraction and reverse transcription using commercial kits were performed according to the corresponding manual.

For the PCR using genomic DNA to evaluate the presence of target genes in transformants, a pair of primer psaD-P (5′—GGGAATTGGAGGTACGACCGAGAT-3′) and psaD-T (5′—AGCTCCGATCCCGTATCAATCAGC-3′) was used, which locating at the psaD promoter and psaD terminator region, respectively. PCR was accomplished using 2 × M5 HiPer plus Taq HiFi PCR mix (with blue dye) (Mei5 Biotechnology Co., Ltd, Beijing, China), as recommended. PCR products were examined on 1% agarose gel by electrophoresis at 120 V for 15 min.

For the PCR using cDNA (qPCR) to verify the success expression of the foreign gene in transformants, a pair of gene specific primer CrtYqF3 (5′—GCACGCCACCATCCAGCAGTTCG—3′) and CrtYqR3 (5′—GCAAGCGGTCCGGGAGTGTCAGC—3′) targeting CrtY was designed. As an internal control, the expression of β-actin was also tested using the primer set Actin-F (5′—ACCCCGTGCTGCTGACTG—3′) and Actin-R (5′-ACGTTGAAGGTCTCGAACA—3′). The qPCR was performed on ABI 7300 Real-time PCR System (Applied Biosystems, Foster City, USA), in a 20 μL volume containing 1 μL cDNA, 10 μL 2 × SYBR®Premix Ex Taq TM II (Takara, Dalian, China), 0.8 μL each primer (10 μM), 0.4 μL ROX dye, and 7 μL nuclease-free ddH2O. The amplification condition was 98 ℃ for 15 s, 40 cycles of 98 ℃ for 10 s and 60 ℃ for 30 s. The Ct value was collected based on the default setting and 2−ΔΔCT method was used to calculate the relative expression level of target gene. All qPCRs were performed at least in triplicates.

Carotenoids extraction, identification and quantification

To extract carotenoids from E. coli and algal cells, harvested cells were dried using a freeze-dryer for 24 h. The carotenoids extraction, identification, and quantification in E. coli were processed as described previously [27]. The carotenoids determination in algal cells was described as following. The dried pellet of algal cells was crushed into powder, and then 10 mg were weight out and transferred into a 10 ml centrifuge tube. After adding 3 mL of cold methanol, cells were sonicated to release carotenoids. The supernatant was collected and filtered into a brown centrifuge tube and stored at − 20 °C for further analysis. Since there are non-target pigments presented in the extracts form algal cells, such as chlorophylls and lutein, a different HPLC detection procedure was applied, using the YMC C30 carotenoid column (4.6 × 250 mm, 5 micron). The HPLC conditions included the flow rate of 1 mL/min, the column temperature of 35 °C, the detection at 450 nm, and the injection volume of 10 μL. The mobile phase consisted of solution A (1% v/v phosphoric acid), solution B (tertiary-methyl-butyl ether), and solution C (methanol). Solution A was maintained at 4% during the whole gradient and the elution was initialed by 15% B and 81% C. The linear gradient included 20% B and 76% C at 2 min, 28% B and 68% C at 2.1 min, 28% B and 68% C at 13 min, 50% B and 46% C at 13.1 min, 70% B and 26% C at 18 min, 15% B and 81% C at 18.1 min, and 15% B and 81% C at 25 min. For the quantification, a calibration curve with coefficiency at higher than 0.99 was constructed using commercial standards, including lutein (HPLC ≥ 90%) and β-carotene (HPLC ≥ 90%) from Shanghai Yuanye Bio-Technology Co., Ltd. (Shanghai, China).

Growth curve construction

To determine the growth of transgenic microalgae, the OD750 was measured in a period of 6 days. The seed culture at the OD750 of 0.3–0.4 was used for inoculation and three biological replicates were set up. The algal seed cells were diluted by TAP liquid medium into a final OD750 of 0.01, followed by the measurement of OD750 every day until Day 6. The measurement was performed on Epoch2 microplate reader (Bio-Tek Instruments, Winooski, VT, USA).

Statistical analysis

All experiments were performed with at least three biological replicates. Data were presented as the mean with standard deviation. The statistical significance between two means was determined by Student’s t-test.

Results

Comparison of alga- and bacterium-driven lycopene β-cyclase in E. coli

To compare the lycopene β-cyclase driven from bacterium and Dunaliella salina on β-carotene production, their performance was investigated in E. coli. After cultivation and induction, the E. coli cells BL21(DE3) without any additional foreigner genes had no additional color (Fig. 2A) and the E. coli cells producing lycopene displayed a red color (Fig. 2B). It is observed that the cell pellet of lycopene-produced E. coli containing either DsLcyb1 or CrtY showed the yellow color (Fig. 2C and Fig. 2D), indicating that the lycopene was converted into other carotenoids with yellow color. Further pigment analysis using HPLC revealed that lycopene-produced E. coli transformed with alga-driven DsLcyb1 or bacterium-driven CrtY generated β-carotene, at the level of 0.74 and 1.18 mg/g DW (dry weight), respectively (Fig. 2E). Statistically, CrtY performed better and produced appreciate 1.59 times of β-carotene than DsLcyb1.

Fig. 2
figure 2

The detection and quantification of β-carotene productivity in E. coli by HPLC analysis. A The cell pellet of E. coli BL21(DE3); B the cell pellet of lycopene-produced E. coli; C the cell pellet of lycopene-produced E. coli with plasmid pET-DsLcyb1; D the cell pellet of lycopene-produced E. coli with plasmid pET-CrtY; E the amount of β-carotene in lycopene-produced E. coli with plasmid pET-DsLcyb1 or pET-CrtY

Full size image

Nuclear transformation of C. reinhardtii and confirmation of transformants

To figure out if the motivated CrtY found in E. coli could promote the β-carotene biosynthesis in microalgae, the codon-optimized CrtY was transferred into C. reinhardtii genome. The PCR was performed to evaluate the successful integration of CrtY into C. reinhardtii nuclear genome, using genomic DNA isolated from colonies grown under antibiotic selection stress. According to the feature of primer set psaD-P/psaD-T which will amplify CrtY gene as well as the native psaD gene in the C. reinhardtii genome, the positive transformants should generate two PCR fragments, including the 813 bp of native psaD gene and the 1590 bp of CrtY gene. Results suggested that the negative control (NC, the wild type of C. reinhardtii) and the positive control (P, the plasmid DNA of pDb124-CrtY) generated PCR fragments in expected size, indicating the good performance of psaD-P/psaD-T in the PCR (Fig. 3). As a result, algal colonies Y35, Y38, Y43, Y51, and Y58 generated two fragments that were in the same size as NC and P, suggesting the successful integration of CrtY in their genome.

Fig. 3
figure 3

Identification of positive transformants using genomic DNA with the primer set psaD-P/psaD-T. M refers to the DNA ladder; P refers to the plasmid DNA of pDb124-CrtY, as the positive control; NC refers to the wild type of C. reinhardtii, as the negative control; ddH2O refers to the double distilled water, as the no template control; Y30, Y35, Y36, Y37, Y38, Y43,Y49, Y51, and Y58 refer to the algal colonies

Full size image

Subsequently, to confirm the successful expression of CrtY in positive transformants of C. reinhardtii, the qPCR was conducted. The primer set CrtYqF3/ CrtYqR3 was specific and located within the coding region of CrtY, no amplification was observed in the wild type of C. reinhardtii. Hence, to normalize the relative expression level of CrtY in transformants, the transformant Y43 was employed as the control. Results suggested that there were significant differences on the relative expression level of CrtY among transformants (Fig. 4). The high expression level of CrtY was found in Y35 and Y58, which is about 12.0 and 9.2 times of that in Y43. Transformants Y38 and Y51 had similar transcripts of CrtY, that were about 2.3 and 2.8 times of that in Y43, respectively.

Fig. 4
figure 4

The relative expression levels of C. reinhardtii transformants based on qPCR analysis. The expression level of actin was set as the internal control and the expression level of CrtY in Y43 was used for data normalization

Full size image

Carotenoids profile and growth of C. reinhardtii transformants

To determine the effect of expressing CrtY in the transgenic C. reinhardtii on carotenoids biosynthesis, pigments were extracted from algal cells suffering from the high light treatment which has been reported as a stimulation to promote carotenoids biosynthesis. The amounts of β-carotene and lutein are expected to increase and reduce in transgenic algal cells, respectively. Based on the HPLC analysis, the β-carotene content in transgenic C. reinhardtii was varied from 23.13 to 30.65 mg/g DW, while that in wild type of C. reinhardtii was 12.48 mg/g. Therefore, all tested transgenic C. reinhardtii produced significant higher amount of β-carotene than the wild type (Fig. 5A), at the confidence of 0.001. The highest amount of β-carotene was found in Y51, which had 2.45 times of β-carotene than the wild type. Compared with β-carotene, the lutein content was much lower, ranging from 4.50 to 5.43 mg/g DW. Statistical analysis revealed that only Y35, Y38, and Y51 had significant higher amount of lutein than the wild type, at the confidence of 0.05, while Y43 and Y58 had similar amount of lutein as the wild type (Fig. 5B). By comparing the data, the highest lutein production was found in Y38, which was only 1.2 times of that in the wild type.

Fig. 5
figure 5

The amount of β-carotene (A) and lutein (B) in the wild type and transgenic C. reinhardtii based on the HPLC analysis. NC indicates the wild type of C. reinhardtii, as the negative control. Y35, Y38, Y43, Y51, and Y58 indicate different strains of transgenic C. reinhardtii. * and *** indicate the statistical significance at the level of 0.05 and 0.001, respectively. ns indicates no statistical significance at the level of 0.05

Full size image

Moreover, to check if the overexpression of CrtY affects the growth of microalgae, the growth curve of transgenic C. reinhardtii was measured. Results suggested that except Y38, which showed obvious growth defect at Day3, all other transgenic C. reinhardtii showed no difference on the growth with the wild type at all determined points (Fig. 6). Moreover, the growth of Y38 was recovered at Day 4 and maintained similar growth status as the wild type. Hence, it was concluded that the overexpression of CrtY had no defective effect on the microalga growth.

Fig. 6
figure 6

The growth curve of the wild type and transgenic C. reinhardtii. NC stands for the wild type of C. reinhardtii, as the negative control. Y35, Y38, Y43, Y51, and Y58 refer to different strains of transgenic C. reinhardtii

Full size image

Discussion

β-Carotene is a terpenoid with high economic value [7]. With the advantage of well-elucidated pathway of β-carotene biosynthesis, lots of efforts were placed to bio-engineer its production with high yield and low cost, mainly using E. coli and yeast as cell factory [8,9,10]. However, only few researches on the production of β-carotene in microalgae were reported, even though microalgae were considered as the green cell factory for drug-related products, due to the advantages of low cultivation cost, fast growth, and fixation of CO2 as the carbon source [28]. Aiming to construct a microalgae strain with high β-carotene productively, a set of experiments was designed in this study, using microalgae Chlamydomonas reinhardtii as the platform.

As documented, the biosynthesis of β-carotene starts from IPP (isopentenyl pyrophosphate), followed by various enzymes including isopentenyl pyrophosphate isomerase, geranylgeranyl diphosphate synthase, phytoene desaturase, phytoene synthase, and lycopene cyclase, the C5 blocks were built into C40 carotene [1]. The lycopene cyclase [EC: 5.5.1.19] which cyclize the linear C40-lycopene and introduce the β- or ε-ionone end groups leads to the formation of β-carotene (containing only β-rings) and α‐carotene (containing one β-ring and one ε-ring) [1,2,3]. Four families of lycopene cyclase have been reported and their similarities with each other are low [19,20,21]. Among them, lycopene β-cyclase introduces one β-ring at one end of lycopene to form γ-carotene, and then introduces another β-ring to the other end to form β-carotene [21]. The lycopene β-cyclases from carotenogenic bacteria (CrtY) and from plants, algae, and cyanobacteria (CrtL-b and LCY-b) were proved to have good activity for carotenoids production in plants and engineered bacteria [21]. In microalgae, it has been reported that the microalga D. salina accumulated the highest amount of natural β-carotene, which is about 10% of the dry weight, leading to the possibility that DsLcyb1 might have superior activity for β-carotene biosynthesis [29, 30]. Besides, the bacterial CrtY has been frequently used to produce β-carotene in E. coli [23]. Therefore, this study selected CrtY from bacteria Pantoea agglomerans and LCY-b from microalga Dunaliella salina (DsLcyb1) as candidates, aiming to improve the β-carotene production in C. reinhardtii by overexpressing an effective lycopene cyclase. According to the results obtained in this study, it was found that CrtY has better activity than DsLcyb1 on β-carotene production in E. coli (Fig. 2). Furthermore, the bacterial CrtY was attempt to integrate into the nuclear genome of C. reinhardtii, with the expect to competitively and dominantly convert lycopene into β-carotene rather than α-carotene. Thereby, the transgenic C. reinhardtii was expected to have increased β-carotene and reduced lutein content. It turns out the overexpression of CrtY dramatically increased the β-carotene from 12.48 mg/g DW to 30.65 mg/g DW, which is about 2.45-fold increment (Fig. 5). However, the reduction of lutein was not observed. By contrast, the lutein content was even slightly increased in some transformants (Fig. 5). It was also found that the transgenic microalgae were grew as well as the wild type (Fig. 6). This finding suggested that the increment of β-carotene was not due to the reduced carotenoids flux into α-carotene, leading to the fact that there was no tradeoff between α-carotene and β-carotene when overexpressing lycopene β-cyclase in C. reinhardtii. It is noted that the expression levels of CrtY in transgenic microalgal strains are not exactly consistent with the β-carotene content, since the highest β-carotene content was found in Y51(Fig. 5A), while the most abundant CrtY transcripts were found in Y35 (Fig. 4). Previously, in a study overexpressing native CrLCYE in C. reinhardtii aiming to improve lutein productivity, the transformants CrCLYE#L6 had the significant lower transcripts but had similar increased lutein content as other transformants [22], implying that post-transcription regulation should be involved during down-stream carotenoids biosynthesis.

In C. reinhardtii, several researches have been conducted to genetically manipulate carotenoids biosynthesis, mainly including the overexpression of endogenous genes and foreigner genes from Chlorella zofingiensis, D. salina, Haematococcus pluvialis, and Xanthophyllomyces dendrorhous to promote carotenoids production [31, 32]. Without exception, no bacteria-driven genes that were widely used in E. coli for carotenoids production were attempted to be used in C. reinhardtii or other microalgae. Commonly, gene expression and its regulation in eukaryotic cells are much complex than in prokaryotic cells [33], leading to the suspicion that the superior gene tested by E. coli can also perform well in eukaryotic cells. No references clearly point out the answer. This study firstly overexpressed a bacterial gene CrtY encoding an enzyme with the function to convert lycopene into β-carotene in C. reinhardtii. This gene was well functioned which was evidenced by dramatically increased β-carotene content in transgenic C. reinhardtii. The results in this study will widen the gene cluster for carotenoids biofortification in microalgae.

Availability of data and materials

The datasets supporting the conclusions of this article are included within the article or the additional file (Additional file 1: Fig. S1).

References

  1. Britton G, Liaaen-Jensen S, Pfander H. Carotenoids Hand Book. Basel: Birkhäuser; 2004.

    Book  Google Scholar 

  2. Maoka T. Recent progress in structural studies of carotenoids in animals and plants. Arch Biochem Biophys. 2009;483:191–5.

    Article  PubMed  CAS  Google Scholar 

  3. Maoka T. Carotenoids as natural functional pigments. J Nat Med. 2020;74:1–16.

    Article  PubMed  CAS  Google Scholar 

  4. Bendich A, Olson JA. Biological actions of carotenoids. FASEB J. 1989;3:1927–32.

    Article  PubMed  CAS  Google Scholar 

  5. Frank HA, Cogdell RJ. Carotenoids in photosynthesis. Photochem Photobiol. 1996;63:257–64.

    Article  PubMed  CAS  Google Scholar 

  6. Demming-Adams B, Adams WW III. Antioxidants in photosynthesis nutrition. Science. 2002;298:2149–53.

    Article  Google Scholar 

  7. Metibemu DS, Ogungbe IV. Carotenoids in drug discovery and medicine: pathways and molecular targets implicated in human diseases. Molecules. 2022;27:6005.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  8. Ashokkumar V, Flora G, Sevanan M, Sripriya R, Chen WH, Park J-H, Rajesh Banu J, Kumar G. Technological advances in the production of carotenoids and their applications -a critical review. Bioresource Technol. 2023;367: 128215.

    Article  CAS  Google Scholar 

  9. Sandmann G. Genetic manipulation of carotenoid biosynthesis: strategies, problems and achievements. Trends Plant Sci. 2001;6:14–7.

    Article  PubMed  CAS  Google Scholar 

  10. Moise AR, Al-Babili S, Wurtzel ET. Mechanistic aspects of carotenoid biosynthesis. Chem Rev. 2014;114:164–93.

    Article  PubMed  CAS  Google Scholar 

  11. Madhavan A, Arun K, Alex D, Anoopkumar A, Emmanual S, Chaturvedi P, Varjani S, Tiwari A, Kumar V, Reshm R, Awasthi MK, Binod P, Aneesh E, Sindhu R. Microbial production of nutraceuticals: metabolic engineering interventions in phenolic compounds poly unsaturated fatty acids and carotenoids synthesis. J Food Sci Technol. 2022;8:1–13.

    Google Scholar 

  12. Charalampia D, Antonios KE, Constantina N, Haralabos KC. Current trends and emerging technologies in biopigment production processes: industrial food and health applications. Int J Hortic Agric Food Sci. 2017;1:33–46.

    Google Scholar 

  13. Zhao J, Li Q, Sun T, Zhu XN, Xu HT, Tang JL, Zhang X, Ma Y. Engineering central metabolic modules of Escherichia coli for improving β-carotene production. Metab Eng. 2013;17:42–50.

    Article  PubMed  CAS  Google Scholar 

  14. Yang J, Guo L. Biosynthesis of β-carotene in engineered E coli using the MEP and MVA pathways. Microb Cell Fact. 2014;13:160.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  15. Mata-Gómez LC, Montañez JC, Méndez-Zavala A, Aguilar CN. Biotechnological production of carotenoids by yeasts: an overview. Microb Cell Fact. 2014;13:12.

    Article  PubMed  PubMed Central  Google Scholar 

  16. Rathod JP, Vira C, Lali AM, Prakash G. Metabolic engineering of Chlamydomonas reinhardtii for enhanced β-carotene and lutein production. Appl Biochem Biotechnol. 2020;190:1457–69.

    Article  PubMed  CAS  Google Scholar 

  17. Cordero BF, Couso I, León R, Rodríguez H, Vargas MA. Enhancement of carotenoids biosynthesis in Chlamydomonas reinhardtii by nuclear transformation using a phytoene synthase gene isolated from Chlorella zofingiensis. Appl Microbiol Biotechnol. 2011;91(2):341–51.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  18. Vikram Singh R, Sambyal K. An overview of β-carotene production: current status and future prospects. Food Biosci. 2022;47: 101717.

    Article  Google Scholar 

  19. Maresca JA, Graham JE, Wu M, Eisen JA, Bryant DA. Identification of a fourth family of lycopene cyclases in photosynthetic bacteria. Proc Natl Acad Sci USA. 2007;104:11784–9.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  20. Krubasik P, Sandmann G. Molecular evolution of lycopene cyclases involved in the formation of carotenoids with ionone end groups. Biochem Soc Trans. 2000;28:806–10.

    Article  PubMed  CAS  Google Scholar 

  21. Zhao Z, Liu Z, Mao X. Biotechnological advances in lycopene β-cyclases. J Agric Food Chem. 2020;68:11895–907.

    Article  PubMed  CAS  Google Scholar 

  22. Tokunaga S, Morimoto D, Koyama T, Kubo Y, Shiroi M, Ohara K, Higashine T, Mori Y, Nakagawa S, Sawayama S. Enhanced lutein production in Chlamydomonas reinhardtii by overexpression of the lycopene epsilon cyclase gene. Appl Biochem Biotechnol. 2021;193:1967–78.

    Article  PubMed  CAS  Google Scholar 

  23. Wang L, Liu Z, Jiang H, Mao X. Biotechnology advances in β-carotene production by microorganisms. Trends Food Sci Tech. 2021;111:322–32.

    Article  CAS  Google Scholar 

  24. Ma T, Zhou Y, Li X, Zhu F, Cheng Y, Liu Y, Deng Z, Liu T. Genome mining of astaxanthin biosynthetic genes from Sphingomonas sp. ATCC 55669 for heterologous overproduction in Escherichia coli. Biotechnol J. 2016;11:228–37.

    Article  PubMed  CAS  Google Scholar 

  25. Froger A, Hall JE. Transformation of plasmid DNA into E coli using the heat shock method. J Vis Exp. 2007;6:253.

    Google Scholar 

  26. Li A, Huang R, Wang C, Hu Q, Li H, Li X. Expression of anti-lipopolysaccharide factor isoform 3 in Chlamydomonas reinhardtii showing high antimicrobial activity. Mar Drugs. 2021;19(5):239.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  27. Huang D, Liu W, Li A, Wang C, Hu Z. Discovery of geranylgeranyl pyrophosphate synthase (GGPPS) paralogs from Haematococcus pluvialis based on Iso-seq analysis and their function on astaxanthin biosynthesis. Mar Drugs. 2019;17(12):696.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  28. Masi A, Leonelli F, Scognamiglio V, Gasperuzzo G, Antonacci A, Terzidis MA. Chlamydomonas reinhardtii: a factory of nutraceutical and food supplements for human health. Molecules. 2023;28(3):1185.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  29. Ye ZW, Jiang JG, Wu GH. Biosynthesis and regulation of carotenoids in Dunaliella: progresses and prospects. Biotechnol Adv. 2008;26:352–60.

    Article  PubMed  CAS  Google Scholar 

  30. Ramos A, Coesel S, Marques A, Rodrigues M, Baumgartner A, Noronha J, Rauter A, Brenig B, Varela J. Isolation and characterization of a stress-inducible Dunaliella salina Lcy-beta gene encoding a functional lycopene beta-cyclase. Appl Microbiol Biotechnol. 2008;79(5):819–28.

    Article  PubMed  CAS  Google Scholar 

  31. Aswini V, Gothandam KM. Genetic manipulation for carotenoid production in microalgae an overview. Curr Res Biotechnol. 2022;4:221–8.

    Article  Google Scholar 

  32. Sirohi P, Verma H, Singh SK, Singh VK, Pandey J, Khusharia S, Kumar D, Kaushalendra TP, Kumar A. Microalgal carotenoids: therapeutic application and latest approaches to enhance the production. Curr Issues Mol Biol. 2022;44:6257–79.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  33. Ha CE, Bhagavan NV. Chapter 23 Regulation of gene expression. In Essentials of medical biochemistry, 3rd ed. Ha CE, Bhagavan NV, (ed) Cambridge: Academic Press; 2023.

    Google Scholar 

Download references

Acknowledgements

We would like to thank Dr. Jiang Xia at the Chinese University of Hong Kong for sharing the plasmid pFZ153.

Funding

This research was supported by China National Key Research and Development Project (No. 2018YFA0902500), National Natural Science Foundation of China (No. 31970366), Guangdong Natural Science Foundation (No. 2021A1515011590) and Guangdong Province Key Research and Development Project (No. 2022B1111070005).

Author information

Author notes

  1. Danqiong Huang and Chenglong Liu contributed equally to this work.

Authors and Affiliations

  1. Guangdong Engineering Research Center for Marine Algal Biotechnology, Guangdong Provincial Key Laboratory for Plant Epigenetics, Shenzhen Engineering Laboratory for Marine Algal Biotechnology, Longhua Innovation Institute for Biotechnology, College of Life Sciences and Oceanography, Shenzhen University, Shenzhen, China

    Danqiong Huang, Chenglong Liu, Mingshan Su, Zhiyong Zeng, Chaogang Wang, Zhangli Hu, Sulin Lou & Hui Li

  2. Key Laboratory of Optoelectronic Devices and Systems of Ministry of Education and Guangdong Province, College of Physics and Optoelectronic Engineering, Shenzhen University, Shenzhen, China

    Chenglong Liu

Authors
  1. Danqiong Huang
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Chenglong Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Mingshan Su
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Zhiyong Zeng
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Chaogang Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Zhangli Hu
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Sulin Lou
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Hui Li
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

DH and HL conceived and designed the research; DH, CL, MS and ZZ performed the experiments; CW participated in data curation; ZH participated in funding acquisition; HL and SL supervised the project; the manuscript was written by DH. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Sulin Lou or Hui Li.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1:

Figure S1. Schematic map of pAC-Lyco and pDb124 used in this study.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Huang, D., Liu, C., Su, M. et al. Enhancement of β-carotene content in Chlamydomonas reinhardtii by expressing bacterium-driven lycopene β-cyclase. Biotechnol Biofuels 16, 127 (2023). https://doi.org/10.1186/s13068-023-02377-1

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s13068-023-02377-1

Keywords

Biotechnology for Biofuels and Bioproducts

ISSN: 2731-3654

Contact us