Skip to main content

Table 3 Nucleotide sequences of used primers

From: Thermoanaerobacterium thermosaccharolyticum β-glucosidase: a glucose-tolerant enzyme with high specific activity for cellobiose

Primer Nucleotide sequence
bgl-1 CCCCATATGTCGGACTTTAACAAGGAC
bgl-2 CCCCTCGAGAATGGTCCTAGTGGAAATAAG
bgl-3 TTTGGCGTGGCGACCGCGAGCTATCAGGTGGAAGG TGCTTACAATGAGGA
bgl-4 CAGAAAATCTTTGTTAAAATCGCTCATATGTATATCT CCTTCTTAAAG
  1. The boldface italic nucleotides represented mutations for optimizing codons.