Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 5 qPCR specific primers used in this study

From: Fermentative hydrogen production from glucose and starch using pure strains and artificial co-cultures of Clostridium spp.

Strain Primer name and sequence (5′ → 3′) ATa (° C) size (bp) Accession number
C. butyricum CWBI1009 RecA-butF AAGCATTAGTGCGTTCTGGAG 60 97 HQ433355
C. pasteurianum RecA-pastF CTCATGTGGGACTTCAAGCA 60 150 HQ433356
  1. a AT-PCR annealing temperature (° C).