Skip to main content

Advertisement

Table 5 qPCR specific primers used in this study

From: Fermentative hydrogen production from glucose and starch using pure strains and artificial co-cultures of Clostridium spp.

Strain Primer name and sequence (5′ → 3′) ATa (° C) size (bp) Accession number
C. butyricum CWBI1009 RecA-butF AAGCATTAGTGCGTTCTGGAG 60 97 HQ433355
  RecA-butR GAATCTCCCATTTCCCCTTC    
  GyrA-butF AGCAATGGGTAGAACTGCATC 60 95 HQ433358
  GyrA-butR ATTCTTCGCCATCAACTGCT    
C. pasteurianum RecA-pastF CTCATGTGGGACTTCAAGCA 60 150 HQ433356
DSM525 RecA-pastR CACCAGGTGTTGTTTCTGGA    
  GyrA-pastF AATGCATCTGGGGTAAGAGG 57 91 HQ433359
  GyrA-pastR CCACAAGTACATCCTTTTCAACA    
  1. a AT-PCR annealing temperature (° C).