Skip to main content

Table 1 The primer pairs used in the PGASO construction

From: PGASO: A synthetic biology tool for engineering a cellulolytic yeast

Primer name Sequence
Cassette construction  
Lac4-KanMx Kl-PLac4-3’End-F 5’-TAGGGCCTGTTTGGCCTCCCGCGGGGATC-3’
Kl-LAC4_46bpScPGap_Dra3_R 5’-TAGCACTCAGTGATTATTTACGTATTCTTTGAAATGGCAGTATTGATAATGATAAACTTATACAACATCGAAGAAGAGTC-3’
ScGapDH-EgIII ScPGapDH-F-BglI 5’-TAGGCCATGACGGCAGTTTATCATTATCAATACTGCC-3’
AFEgIII_ScPGapDH_R 5’-GTAGAGAATTTCATTTTTTTGTTTGTTTATGTGTGTTTAT -3’
ScPGapDH_AFEgIII_F 5’-ATAAACACACATAAACAAACAAAAAAATGAAATTCTCTAC-3’
ScTTGap_EgIII_R 5’-AAGATTTAAAGTAAATTCACGCGGCCGCCTACTTTCTTGCGAGACACG -3’
EgIII_ScTTGap_F 5’-CGTGTCTCGCAAGAAAGTAGGCGGCCGCGTGAATTTACTTTAAATCTT-3’
ScTTGap_Kl_PGapDH_R 5’-CTTTTCCATTTGCCTTCGCGCTTGCCTGTACGGTCGTTACCATACTTGGCGGAAAAAATTCATTTG -3’
KlGapDH-CBHI Kl-PGapDH-F 5’-AGTATGGTAACGACCGTACAGGCAA-3’
AFCBHI_KlPGapDH_R 5’-GTAGAGAATTTCATTTTTTTTGTGTAATATTCTTTTTTTT-3’
KlPGapDH_AFCBHI_F 5’-AAAAAAAAGAATATTACACAAAAAAAATGAAATTCTCTAC -3’
ScTTGap_CBHI_R 5’-AAGATTTAAAGTAAATTCACGCGGCCGCTTACAGGCACTGAGAGTAGT -3’
CBHI_ScTTGap_F 5’-ACTACTCTCAGTGCCTGTAAGCGGCCGCGTGAATTTACTTTAAATCTT -3’
ScTTGap_Kl_PADHI_R 5’-TGGTAACGACCGTACAGGCAAGCGCGAAGGCAAATGGAAAAGCTGGTGGCGGAAAAAATTCATTTG-3’
KlADHI-GFP Kl-PADHI-F 5’-CCAGCTTTTCCATTTGCCTTCGCGCTTGCC-3’
GFPKLADHI-R 5’-TCCTCGCCCTTGCTCACCATTTTATCTTTTTTTAGTATAGAGT-3’
KLADHIGFP-F 5’-ACTCTATACTAAAAAAAGATAAAATGGTGAGCAAGGGCGAGGA-3’
ScTTGap_46bpScPADHI_CGA-BglI_R 5’-TAGGCCGTCGTGGCATGTATGGGTTTGGTTGCCAGAAAAGAGGAAGTCCATATTGTACAC-3’
ScADHI-NpaBGS ScPADHI_CGA-BglI_F 5’-TAGGCCACGACGGCGTGTACAATATGGACTTCCTCTTTTC -3’
NpaBGS-BglII-F 5’-ACGAGATCTAAAAAAATGAAATTCTCT-3’
NpaBGS-SmaI-R 5’-TATCCCGGGTTAGTAAAGTTTGTAAGC-3’
Kl-PLac4 -5’End-R-SfiI 5’-AGGGCCAAGAAGGCCAGCCGCGGAAATTTAGGAATTTTAAAC-3’
Checking primer  
Kan Kan-BglII-F 5’-AAAAAGATCTGCCACCATGGGTAAGGAAAAGACTC-3’
Kan-XbaI-R 5’-AAAAATCTAGATTAGAAAAACTCATCGAGCAT-3’
EgIII EgIII-1084 F 5’-GACATGTGCCAGCAAATCCAATATC-3’
ScTTGap_Kl_PGapDH_R 5’CTTTTCCATTTGCCTTCGCGCTTGCCTGTACGGTCGTTACCATACTTGGCGGAAAAAATTCATTTG-3’
CBHI Kl-PGapDH-F 5’-AGTATGGTAACGACCGTACAGGCAA-3’
CBHI-218R 5’-AAGTGTTGCCATCGTAGCAGTTCGT-3’
GFP GFP-BglII-F 5’-ACGAGATCTATGGTGAGCAAGGGCGA-3’
GFP-SmaI-R 5’-TATCCCGGGTTACTTGTACAGCTCGTCCA-3’
NpaBGS NpaBGS-1422-F 5’-TCCAGGTCCAGTTAATGTTCCATTC-3’
NpaBGS-SmaI-R 5’-TATCCCGGGTTAGTAAAGTTTGTAAGC-3’
Internal primer  
amplicon L-K Lac4-Primer1 5’-ACACACGTAAACGCGCTCGGT-3’
Kan-126R 5’-TACAATCGATAGATTGTCGCACCTG-3’
Kan-673 F 5’-CAGGATCTTGCCATCCTATGGAACT-3’
amplicon K-E EgIII-528R 5’-TACTTGGAAATGCTCGTGGAATCAA-3’
amplicon E-C EgIII-1084 F 5’-GACATGTGCCAGCAAATCCAATATC-3’
CBHI-218R 5’-AAGTGTTGCCATCGTAGCAGTTCGT-3’
amplicon C-G CBHI-585 F 5’-CGATCTGAAGTTCATCAATGGCCAG-3’
GFP-150R 5’-GTGCAGATGAACTTCAGGGTCAGCT-3’
amplicon G-N GFP-492 F 5’-GAACTTCAAGATCCGCCACAACATC-3’
NpaBGS-403R 5’-CACATTCACCAACATAGAATGGATC-3’
amplicon N-L NpaBGS −1422 F 5’-TCCAGGTCCAGTTAATGTTCCATTC-3’
Lac4-3'-436-R 5’-ACTCTACATGCGACTTGGAAGGC-3’
UPL system QPCR primer  
Kan Kan-UPL#144 F 5’- AGACTAAACTGGCTGACGGAAT-3’
Kan-UPL#144R 5’- CATCAGGAGTACGGATAAAATGC -3’
EgIII EgIII-UPL#77 F 5’- TGGCTCCGACAGAACAATC -3’
EgIII-UPL#77R 5’- GTCTTGTATGCAGGACTGAACG -3’
CBHI CBHI-UPL#77 F 5’- ACATCAAGTTCGGACCCATT-3’
CBHI-UPL#77R 5’- GGTAGGTCCGGGAGAGCTT-3’
GFP GFP-UPL#148 F 5’- TCTATATCATGGCCGACAAGC-3’
GFP-UPL#148 F 5’- GTTGTGGCGGATCTTGAAGT-3’
NpaBGS NpaBGS-UPL#150 F 5’- GAAGCTGTAATGGAAGAAGATGG-3’
NpaBGS-UPL#150R 5’- CTGGGAATGAAAGGAAAATCAT-3’
Alg9 ALG9-UPL#151 F 5’- GTGGGTCTATACCACGTCTCATC-3’
Actin ALG9-UPL#151R 5’- TCCAAATATAACGAATTTAAGCAACTT-3’
ACTIN-UPL #9 F 5’- GCGTAGATTGGAACAACGTG-3’
ACTIN-UPL #9R 5’- AGAACTACCGGTATTGTGTTGGA-3’
\