Skip to main content

Advertisement

Table 4 List of primers used in this study

From: Functional expression and characterization of five wax ester synthases in Saccharomyces cerevisiae and their utility for biodiesel production

Gene product Primer sequence 5'→3'
  forward reverse
Wax ester synthase from A. baylyi ADP1 [GenBank: AF529086] CGGGATCCCGCTCGAGATGCGTCCATT GGGGTACCCCAAGCTTGGGTTAGTTTGCAG
Wax ester synthase from M. hydrocarbonoclasticus DSM 8798 (EF219377) CGGGATCCCGCTCGAGATGAAGAGATTAGG GGGGTACCCCAAGCTTGGGTTACTTTCTAGTACG
Wax ester synthase from R. opacus PD630 (GQ923886) CGGGATCCCGCTCGAGTTGACCGACGTGATTAC GGGGTACCCCAAGCTTGGGTTAGCTAGCCACCACC
Wax ester synthase from Mus musculus C57BL/6 (AY611032) CGGGATCCCGCTCGAGATGTTCTGGCCAACC GGGGTACCCCAAGCTTGGGTTAAACAATGACCAAC
Wax ester synthase from P. arcticus 273-4 (YP_263530) CGGGATCCCGCTCGAGATGAGATTACTGACCGCTGT GGGGTACCCCAAGCTTGGGTTAAGGGGCCAACT
Acetyl-CoA carboxylase [GenBank: NM_001183193] from S. cerevisiae ATTTGCGGCCGCTTTAGTTTCTACCATGAGCGAAG GGCGAGCTCGCAAGGTTTATTTCAAAGTCTTC