Skip to main content

Table 2 Primers pairs used for q-PCR analysis with target gene information

From: Transcriptome profiling of Zymomonas mobilis under ethanol stress

Primary Locus Gene Function Forward primer (5to 3) Reverse primer (5to 3) Product size (bp) aArray bqPCR
ZMO0265   hypothetical protein TAAACAGCAGATGACCTT ATATTGGACCGATTGGAA 100 2.3 2.3
ZMO0546   sulphate transporter TGTCCTGACTCATAATCT CGCTTATTCTCTTCATCA 120 3 4.8
ZMO0557   hypothetical protein AGATTATCAGGACTGGAA TAACATTATCAGCATCGT 113 1.5 3.1
ZMO1417   DEAD/DEAH box helicase domain-containing protein TTATTGCCAATGACGAAC TTTTCCATGACAAAGTTTTC 100 1.5 3.1
ZMO1425   thiamine monophosphate synthase TCATTATCGCTTGCCCTTCA GAGCCGAATCAGCCAGAA 101 1.1 4.9
ZMO1802   hypothetical protein TGCTTATGCAGTGTTTGG TCAGGAAGGTGTAGAGAC 94 1.1 3.5
ZMO1804   amino acid permease-associated domain-containing protein TTTATGGATTTGATACTGTC CGCTACACCAATATAGAT 119 1.4 3.71
ZZM4_0036   protein of unknown function DUF264 CCAGAATAGTGAAGAAGG ATCAAGACCTCTAAGTTG 109 1.4 1.13
pzmob1_p05   hypothetical protein TTCCAATCGGTTCAATTAGT CAGCCATAGTATCGGTAAG 100 2.11 4.86
pzmob1_p07   hypothetical protein ATGCTGCTTGGTTTGTTA GTCATCACAATAGGTAGTCT 107 2.66 4.09
ZMO1064 pspB phage shock protein B TTAGTCTGCCTTATTCTG CTCATAAAGCTCTTCAATC 120 1.3 2.0
ZMO0062   aldo/keto reductase CAACCCGAATATAATCTTTA AAGCCAGACTGTAATAAG 103 −1.52 −4.7
Endogenous control      
  1. aArray: the log2 based microarray ratio of the gene expression (ethanol stress/normal).
  2. bqPCR: the log2 based qPCR ratio of the gene expression (ethanol stress/normal).